Pages
Products
Support
CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER

Rapid and Efficient Gene Editing in Human Pluripotent Stem Cells via FLPe Recombinase-Mediated Cassette Exchange at the AAVS1 Locus

Targeted genome recombination has advanced to the point that it has changed research in several areas, including stem cell biology. Human pluripotent stem cells (hPSCs) may now undergo genetic alteration more efficiently thanks to methods like CRISPR-Cas9. However, the procedure still takes a long time. This procedure uses site-specific targeted recombinases such as FLPe to address the demand for more rapid and dependable gene editing techniques in hPSCs.

Experimental Materials and Recommended Services

NameCommentsRelated Products and Services
Human Pluripotent Stem Cells (hPSC) master cell linesAct as the main cellular template used in gene editing.Custom CRISPR iPSC Services
CRISPRa Stable Cell Lines
CRISPR/Cas9 Gene Fusion Cell Line Services
Recombineering Based Microbe Genome Editing Service
Drug-resistant iMEF (iDR4)Establish a culture and transfection environment for hPSCs that is conducive to their survival and proliferation.
pFLPe (plasmid encoding FLPe recombinase)Encodes FLPe recombinase, an enzyme that facilitates the site-specific recombination in the AAVS1 locus necessary for cassette exchange.CMV-FLPo-Puro Lentivirus (LV00983Z)
pRSV-Rev (OVT2821)
ER50-SpCas9-ER50 (OVT3023)
pCAG-Flpe

Procedure

1. Preparation of the FRT-containing hPSC Master Cell Line for Transfection

1.1. Culture hESC/iPSC master cell lines according to established protocols, either in feeder-free iPSC media or with or without inactivated mouse embryonic fibroblasts (iMEF).

1.2. Prepare 2 wells for each experimental condition in a 6-well plate if using feeders or 1 well if feeder-free.

1.3. Plate drug-resistant immature embryos (iMEF; iDR4) at 60–70% confluency. Apply 0.5 mL of 0.1% gelatin solution to the required wells on a 12-well plate, then incubate for 5 minutes at room temperature. Place 125,000 iDR4s on each well and use iMEF medium to incubate overnight.

2. hPSC Transfection by Nucleofection

2.1. Prior to culture, incubate hESC/iPSC cultures for one hour at 37 °C in new medium containing 10 µM Rho-associated protein kinase (ROCK) inhibitor (Y-27632).

2.2. Assign conditions to the nucleofection plating medium. After using 500 µL of nucleofection plating media, wash the wells with room temperature PBS. Retain the remaining 500 µL at 37 °C until further use.

2.3. Separate the hESC/iPSC into a suspension of one cell. After washing with PBS, add accutase or trypsin as necessary. Gather the cells in an inert container.

2.4. Use PBS to resuspend the cell pellet at a density of 106 cells/mL. Pour two milliliters (mL) into each sterile, clean 15 mL tube.

2.5. Create plasmid mixtures of RMCE donor-pFLPe in up to 10 µL of volume.

2.6. Carry out nucleofection in ideal circumstances. Drop-wise place cells on a 12-well plate with plating media and iDR4.

2.7. To allow for cell recovery in the presence of a 10 µM ROCK inhibitor, incubate for 24 hours before switching medium (Y-27632).

3. Positive and Negative Selection of Cells Undergoing RMCE

3.1. Alternate media culture every day. Using 100 ng/mL of puromycin, begin selection two to three days after transfection.

3.2. Monitor cell proliferation and modify the puromycin concentration as necessary. Up to a maximum of 250 ng/mL, increase in increments of 25–50 ng/mL. For five to seven days, keep up the puromycin selection.

3.3. Start the puromycin selection process with 0.5 µM FIAU and wait three to four days. Every day switch around the media, and don't let FIAU last more than seven days at a time.

Fig 1 illustrates the process of generating the RMCE-suitable Master Cell Line and compares the efficiency of gene targeting with RMCE in the AAVS1 locus. (doi: 10.3791/54718)Figure 1. AAVS1 Gene Targeting vs. RMCE. Left: It takes three months to target a gene using ZFNs and WT cells. Correct: In 15 days, RMCE using FLPe vectors produces completely described lines. (Ordovás L, et al., 2016)

Table 1. Primer Sets used for PCR Genotyping

AssayForwardReverseAmpliconPCR Cycle
5'JA MCLCACTTTGAGCTCTACTGGCTTCCGTTACTATGGGAACATACGTCA1.1 Kb95 ºC, 5' – [95 ºC, 30'' – 68 ºC (-0.5 ºC/cycle), 1' 30'']X15 – [95 ºC, 30'' – 58 ºC, 30'' – 72 ºC, 1' 30'']X25 – 72 ºC, 5'
3'JA MCLTAACTGAAACACGGAAGGAGAAGGCAGCCTGGTAGACA1.4 Kb95 ºC, 5' – [95 ºC, 30'' – 68 ºC (-0.5 ºC/cycle), 1' 30'']X15 – [95 ºC, 30'' – 58 ºC, 30'' – 72 ºC, 1' 30'']X25 – 72 ºC, 5'
5'JA RMCELCACTTTGAGCTCTACTGGCTTCCATGTTAGAAGACTTCCTCTGC1.1 Kb95 ºC, 5' – [95 ºC, 30'' – 68 ºC (-0.5 ºC/cycle), 1' 30'']X15 – [95 ºC, 30'' – 58 ºC, 30'' – 72 ºC, 1' 30'']X25 – 72 ºC, 5'
3'JA RMCELTTCACTGCATTCTAGTTGTGGAAGGCAGCCTGGTAGACA1.5 Kb95 ºC, 5' – [95 ºC, 30'' – 68 ºC (-0.5 ºC/cycle), 1' 30'']X15 – [95 ºC, 30'' – 58 ºC, 30'' – 72 ºC, 1' 30'']X25 – 72 ºC, 5'
5'RI DONORGTACTTTGGGGTTGTCCAGTTGTAAAACGACGGCCAG0.5 Kb95 ºC, 5' – [95 ºC, 30'' - 60 ºC, 30'' - 72 ºC, 30'']X25 – 72 ºC, 5'
3'RI DONORCCTGAGTTCTAACTTTGGCTCACACAGGAAACAGCTATGAC0.5 Kb95 ºC, 5' – [95 ºC, 30'' - 60 ºC, 30'' - 72 ºC, 30'']X25 – 72 ºC, 5'
RI FLPeCCTAGCTACTTTCATCAATTGTGGTATGCTTCCTTCAGCACTAC0.65 Kb95 ºC, 5' – [95 ºC, 30'' - 60 ºC, 30'' - 72 ºC, 30'']X25 – 72 ºC, 5'

4. Expansion and Characterization of RMCE Lines

4.1. Following conventional techniques, divide resistant RMCE colonies for further development when selection is complete, usually on days 14 or 15.

4.2. Plate cells for characterisation and growth. WT and the master cell line should be used as characterisation controls.

4.3. Spin down cells and split the sample for flow cytometry and DNA analysis.

4.4. Examine DNA samples and flow cytometry data to verify RMCE efficiency and the lack of random integration events.

This protocol enables the rapid and efficient generation of gene-edited hPSC lines through FLPe recombinase-mediated cassette exchange at the AAVS1 locus. Because of the method's high efficiency and dependability, transgenesis-mediated research and studies that compare with human pluripotent stem cells can benefit greatly from it. The robustness of the technique is demonstrated by the resultant lines, which are free from random integration occurrences.

* For research use only. Not intended for any clinical use.
Quick Inquiry