Pages
Products
Support
CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER

Dual-Fluorescence Flow Cytometry for Protein Level Analysis

This protocol describes a method to study protein levels at a steady state using a dual-fluorescence flow cytometry-based assay. The protein of interest is genetically fused to enhanced GFP (eGFP), followed by a viral 2A self-cleaving peptide sequence and a second fluorescent protein, mCherry. This system allows for the assessment of protein abundance with normalization for transcriptional differences and variability in transfection efficiency.

Key Components

1. Protein of interest fused to GFP

2. 2A self-cleaving peptide

3. mCherry fluorescent protein

Detailed Procedure

1. Cloning of Dual Fluorescence Reporter Constructs

a) Primer Design

  • Design primers for amplification of the gene of interest, eGFP, and mCherry.
  • Include 20-30 bp overlaps between neighboring fragments for assembly.
  • For the gene of interest: the forward primer should contain overlap with vector, Kozak sequence, and start codon.
  • For eGFP: reverse primer should have no stop codon and contain T2A sequence overhang.
  • For mCherry: include T2A sequence in forward primer, stop codon in reverse primer

Table 1. DNA oligo sequences

PRIMER NAME DNA SEQUENCE
PLENTL_CMV_EGFP_F TGTGGTGGAATTCTGCAGATGCCACCATGGTGAGCAAGGGCGAGG
EGFP_T2A _GIBSON_R CCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCCTTGTACAGCTCGTCCATGC
T2A-MCHERRY-F TCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAGTGAGCAAGGGCGAGGAGGA
MCHERRY-PLENTIR CGGCCGCCACTGTGCTGGATTTACTTGTACAGCTCGTCCATG
PLENTLCMV-ADRB1-F TGTGGTGGAATTCTGCAGATGCCACCATGGGCGCGGGGGTGCTCG
ADRB1(NOSTOP)_GFP_R ACAGCTCCTCGCCCTTGCTCACCACCTTGGATTCCGAGGCGA
EGFP-F GTGAGCAAGGGCGAGGAGCTGT
PLENTI_CMV_DENV _NS4A_F TGTGGTGGAATTCTGCAGATGCCACCATGTCTCTGACCCTGAACCTAATCAC
DENY_NSAB_GFP-R TGAACAGCTCCTCGCCCTTGCTCACCCTTCTTGTGTTGGTTGTGTTC

b) DNA Amplification

  • Use KAPA HiFi HotStart ReadyMix for high-fidelity PCR
  • Run amplified fragments on 1% agarose gel
  • Extract bands using a gel purification kit

c) Assembly and Transformation

  • Assemble purified PCR fragments with EcoRV-linearized and CIP-treated pLenti CMV Puro DEST using NEBuilder HiFi DNA Assembly Master Mix
  • Transform Stbl3 E. coli by heat shock at 42°C for 45 seconds
  • Recover bacteria in S.O.C. medium at 30°C for 1 hour
  • Plate on agar with 100 μg/ml Carbenicillin

d) Plasmid Extraction and Verification

  • Grow single colonies in 50 ml LB broth with Carbenicillin
  • Extract plasmid DNA using Midiprep kit
  • Verify plasmid insert by Sanger sequencing

Figure 1 illustrates the experimental design for a dual fluorescence cytometry assay, showing the schematic of the gene expression cassette and workflow, where the eGFP:mCherry ratio is used to assess changes in protein levels under different experimental conditions.Figure 1. Experimental design for dual fluorescence cytometry assay. (Ngo, A. M., et al., 2020)

2. Transfection of Cell Lines

a) Cell Preparation

  • Plate ~3 x 10⁵ 293FT cells (both WT and EMC4 KO genotypes) in 12-well plates
  • Aim for 70-80% confluency at time of transfection

b) Transfection

  • Use Mirus TransIT-LT1 or Lipofectamine 3000 Transfection Reagent
  • Dilute plasmid DNA in serum-free media or OptiMEM
  • Add transfection reagent according to the manufacturer's instructions
  • Add DNA-lipid complexes dropwise to cells

3. Flow Cytometry Analysis

a) Sample Preparation (24-48 hours post-transfection)

  • Detach cells with 100 μl 0.05% Trypsin-EDTA per well (3 min at 37°C)
  • Inactivate trypsin with an equal volume of FBS-containing medium
  • Pass cells through a 35 μm cell strainer for single-cell suspension

b) Flow Cytometry

  • Use CytoFLEX S Flow Cytometer with 488 and 561nm lasers
  • Set up gating using untransfected cells:
    1. Forward (FSC) and side scatter (SSC)
    2. Height and area of FSC for singlet gate
    3. mCherry fluorescence (transfected cells)
    4. eGFP fluorescence
  • Analyze samples (eGFP-2A-mCherry control and protein of interest constructs)
  • Record 5x10³-5x10⁴ mCherry-positive events per sample

With over a decade of experience, Creative Biogene not only offers top-tier Stable Reporter Cell Lines but also provides Customized Cell Line Services, tailored to streamline your transfection and analysis workflows. Ideal for gene expression studies, these cell lines deliver reliable, long-term expression of fluorescent or luminescent reporters such as mCherry and eGFP, ensuring consistent results in flow cytometry experiments.

4. Data Analysis

a) Initial Data Processing

  • Export FCS files from CytExpert software
  • Import into FlowJo 10 for FACS analysis
  • Apply gating strategy: FSC-H/SSC-H, FSC-H/FSC-A, ECD-H/FSC-H, FITC-H/FSC-H
  • Export relative intensity values of mCherry positive populations as CSV files

b) Ratio Calculation and Normalization

  • Calculate eGFP-to-mCherry ratios for each cell using Microsoft Excel
  • Use eGFP-2A-mCherry only construct to calculate mean ratio as scaling factor
  • Apply scaling factor to normalize all other samples

c) Data Visualization

Import normalized eGFP-to-mCherry values into Prism 8

Generate frequency distribution histograms for each sample

Key Materials and Equipment

1. Cells: 293FT (WT and EMC4-KO)

2. Plasmids: pLenti CMV Puro DEST (w118-1), eGFP and mCherry coding sequences

3. Reagents: KAPA HiFi HotStart ReadyMix, NEBuilder HiFi DNA Assembly Master Mix, TransIT-LT1 or Lipofectamine 3000

4. Equipment: Nanodrop One, CytoFLEX S Flow Cytometer, PCR machine, cell culture incubator

Applications

1. Study expression levels of specific proteins under various cellular conditions

2. Investigate effects of genetic perturbations, drug treatments, or cellular stress on protein levels

3. Assess the impact of chaperone proteins or cellular machinery on protein stability

Notes and Troubleshooting

1. Optimize PCR conditions for each gene of interest to ensure high-fidelity amplification

2. Verify all plasmid constructs by sequencing before use

3. Optimize transfection conditions for your specific cell line to maximize efficiency

4. Include appropriate controls: untransfected cells, eGFP-2A-mCherry only construct

5. Ensure proper compensation when using multiple fluorophores in flow cytometry

6. Be aware of potential artifacts from protein overexpression or tag interference

7. Consider the impact of cell cycle or cell health on protein expression levels

* For research use only. Not intended for any clinical use.
Quick Inquiry