Single Guide RNA Library Design and Construction Protocol

Experiment Summary

This protocol describes how to generate a single guide RNA (sgRNA) library for use in genetic screens.

Materials

Agarose gels (1.0% and 2.0%)
BsmBI
Endura electrocompetent cells
Ethidium bromide
Gel extraction kit
Gibson assembly master mix
LB-ampicillin agar plates
LB (Luria-Bertani) liquid medium
Lentiviral single guide RNA (sgRNA) expression plasmid
Two expression plasmids are suitable-lentiCRISPR v2 (sgRNA expression plasmid with Cas9) or lentiGuide-Puro (sgRNA expression plasmid without Cas9).
Library polymerase chain reaction (PCR) primers
Forward: GGCTTTATATATCTTGTGGAAAGGACGAAACACCG
Reverse: CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
NEBuffer 3.1
Oligonucleotides, custom-made/ordered
Phusion High-Fidelity PCR Master Mix with HF Buffer
Plasmid Plus Maxi Kit
Recovery medium
Water (H₂O), PCR-grade

Equipment

Bacterial shaker(s) (at 30°C and 37°C)
E. coli Pulser Transformation Apparatus
Tubes (1.5-mL)
Flask (500-mL)
Gel electrophoresis apparatus
Gel imager
Heat blocks (at 50°C and 55°C)
Ice
Incubator(s) (at 30°C and 37°C)
MicroPulser Cuvettes
NanoDrop spectrophotometer
Online sgRNA sequence analysis tools
Pipette
Gradient PCR instrument
Water bath
x-tracta gel extractor

Procedure

A. sgRNA Sequence Design

Obtain a list of sgRNA sequences targeting the genes of interest.
Investigators have a wide choice of online tools for determining sgRNA sequences that possess high target specificity and/or cleavage activity. For human and mouse genes, we have generated a set of sgRNA sequences that can be accessed at http://www.broadinstitute.org/~timw/CRISPR/. These sets of sgRNA predictions have been experimentally validated to show high on-target cleavage activity, and we recommend their use here.
Prepend the 5′ universal flanking sequence: TATCTTGTGGAAAGGACGAAACACC.
Append the 3′ universal flanking sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAAT.
Order custom oligonucleotide pools.

B. Vector Preparation

Streak out a bacterial stab culture of sgRNA lentiviral expression vector on LB-amp plates and incubate overnight at 30°C.
Pick a single colony and seed into a 500-mL Erlenmeyer flask containing 100 mL of LB liquid medium containing 100 µg/mL ampicillin.
Incubate culture overnight at 30°C in a rotating bacterial shaker.
Prepare plasmid DNA from the bacterial culture using the Plasmid Plus Maxi Kit.
Assemble the following digestion reaction on ice.

Lentiviral sgRNA expression plasmid	3 µg
NEBuffer 3.1	3 µL
BsmBI	3 µL
H₂O	to 30 µL

Incubate overnight at 55°C in a water bath.
Run out the reaction on an ethidium-bromide-stained 1% agarose gel. Visualize the digested bands using a standard gel imager.
Cut the digested vector backbone using an x-tracta gel extractor tool.
Extract DNA using the Gel Extraction Kit, eluting in 10 µL of water.

C. Library Amplification and Cloning

Assemble four replicates of the following PCR on ice, as follows.

Synthesized oligonucleotides	1 µL
Forward library PCR primer (10 µM)	2 µL
BsmBI	3 µL
Reverse library PCR primer (10 µM)	2 µL
Phusion High-Fidelity PCR Master Mix with HF Buffer	25 µL
H₂O	to 30 µL

Amplify reactions in a thermocycler using the following program, varying the total number of cycles for each replicate.

1 cycle	98°C	2 min
8, 10, 12 or 16 cycles	98°C	10 sec
	60°C	15 sec
	72°C	45 sec
1 cycle	72°C	5 min
1 cycle	4°C	Hold

Run out the reactions on an ethidium-bromide-stained 2% agarose gel. Visualize the PCR bands using a standard gel imager.
For all reactions yielding a visible product at 92 base pairs, cut out the band using an x-tracta gel extractor tool.
Extract DNA using the Gel Extraction Kit, eluting in 10 µL of water.
Determine the PCR product concentrations using a NanoDrop spectrophotometer. Proceed to Gibson Assembly cloning using the sample amplified for the fewest cycles, with a product concentration >10 ng/µL.
Assemble two replicates of the following Gibson Assembly reaction on ice.

Digested vector from Step B-9	100 ng
Gibson Assembly Master Mix	10 µL
H₂O	to 30 µL

Add 1 µL of the library PCR product to one reaction and add 1 µL of water to the other.
Incubate for 1 h at 50°C.
Place reactions on ice after completion.

D. Library Transformation

Warm Recovery Medium for 30 min in a 37°C water bath.
Warm an LB-ampicillin agar plate for 30 min in a 37°C incubator.
Thaw one vial of Endura Electrocompetent Cells and aliquot cells into two tubes on ice for 15 min.
Place two MicroPulser Cuvettes on ice.
For each reaction (control- and insert-containing) proceed as follows:
1) Add 1 µL of the Gibson Assembly reaction product to bacterial cells.
2) Transfer 25 µL of the bacterial cell and Gibson Assembly reaction product mixture into cuvettes.
3) Place cuvette into an Escherichia coli Pulser Transformation Apparatus and electroporate at 1.8 kV.
4) Quickly add 975 µL of the Recovery Medium into the cuvette and pipette up and down three times to resuspend the cells.
5) Transfer mixture to a 1.5-mL microcentrifuge tube.
6) Place the tube in a shaking incubator for 1 h at 37°C.
7) Serially dilute 10 µL of the transformation mixture in Recovery Medium four times, using a dilution factor of 1/10 at each step.
8) Spot 10 µL of each dilution onto an LB-ampicillin plate.
9) Incubate plate overnight at 30°C.
For insert-containing reaction only, proceed as follows:
1) Seed the remainder of the transformation mixture into a 500-mL Erlenmeyer flask containing 100 mL of LB liquid medium containing 100 µg/mL ampicillin.
2) Incubate culture overnight at 30°C.
3) If the transformation efficiency, as assessed by the serial plating, exceeds 20-fold of the library size and the transformation efficiency of the control reaction is <1% of the insert-containing reaction, then prepare plasmid DNA from the bacterial culture using the Plasmid Plus Maxi Kit.
To assess recombination, run out the amplified plasmid on an ethidium-bromide-stained 1% agarose gel. Visualize the plasmid DNA using a standard gel imager.

* For research use only. Not intended for any clinical use.

Quick Inquiry

Single Guide RNA Library Design and Construction Protocol

Experiment Summary

Materials

Equipment

Procedure

Related Products and Services at Creative Biogene