Pages
Products
Support
CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER

Single Guide RNA Library Design and Construction Protocol

Experiment Summary

This protocol describes how to generate a single guide RNA (sgRNA) library for use in genetic screens.

Materials

  1. Agarose gels (1.0% and 2.0%)
  2. BsmBI
  3. Endura electrocompetent cells
  4. Ethidium bromide
  5. Gel extraction kit
  6. Gibson assembly master mix
  7. LB-ampicillin agar plates
  8. LB (Luria-Bertani) liquid medium
  9. Lentiviral single guide RNA (sgRNA) expression plasmid
    Two expression plasmids are suitable-lentiCRISPR v2 (sgRNA expression plasmid with Cas9) or lentiGuide-Puro (sgRNA expression plasmid without Cas9).
  10. Library polymerase chain reaction (PCR) primers
    Forward: GGCTTTATATATCTTGTGGAAAGGACGAAACACCG
    Reverse: CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
  11. NEBuffer 3.1
  12. Oligonucleotides, custom-made/ordered
  13. Phusion High-Fidelity PCR Master Mix with HF Buffer
  14. Plasmid Plus Maxi Kit
  15. Recovery medium
  16. Water (H2O), PCR-grade

Equipment

  1. Bacterial shaker(s) (at 30°C and 37°C)
  2. E. coli Pulser Transformation Apparatus
  3. Tubes (1.5-mL)
  4. Flask (500-mL)
  5. Gel electrophoresis apparatus
  6. Gel imager
  7. Heat blocks (at 50°C and 55°C)
  8. Ice
  9. Incubator(s) (at 30°C and 37°C)
  10. MicroPulser Cuvettes
  11. NanoDrop spectrophotometer
  12. Online sgRNA sequence analysis tools
  13. Pipette
  14. Gradient PCR instrument
  15. Water bath
  16. x-tracta gel extractor

Procedure

A. sgRNA Sequence Design

  1. Obtain a list of sgRNA sequences targeting the genes of interest.
    Investigators have a wide choice of online tools for determining sgRNA sequences that possess high target specificity and/or cleavage activity. For human and mouse genes, we have generated a set of sgRNA sequences that can be accessed at http://www.broadinstitute.org/~timw/CRISPR/. These sets of sgRNA predictions have been experimentally validated to show high on-target cleavage activity, and we recommend their use here.
  2. Prepend the 5′ universal flanking sequence: TATCTTGTGGAAAGGACGAAACACC.
  3. Append the 3′ universal flanking sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAAT.
  4. Order custom oligonucleotide pools.

B. Vector Preparation

  1. Streak out a bacterial stab culture of sgRNA lentiviral expression vector on LB-amp plates and incubate overnight at 30°C.
  2. Pick a single colony and seed into a 500-mL Erlenmeyer flask containing 100 mL of LB liquid medium containing 100 µg/mL ampicillin.
  3. Incubate culture overnight at 30°C in a rotating bacterial shaker.
  4. Prepare plasmid DNA from the bacterial culture using the Plasmid Plus Maxi Kit.
  5. Assemble the following digestion reaction on ice.
  6. Lentiviral sgRNA expression plasmid3 µg
    NEBuffer 3.13 µL
    BsmBI3 µL
    H2Oto 30 µL
  7. Incubate overnight at 55°C in a water bath.
  8. Run out the reaction on an ethidium-bromide-stained 1% agarose gel. Visualize the digested bands using a standard gel imager.
  9. Cut the digested vector backbone using an x-tracta gel extractor tool.
  10. Extract DNA using the Gel Extraction Kit, eluting in 10 µL of water.

C. Library Amplification and Cloning

  1. Assemble four replicates of the following PCR on ice, as follows.
  2. Synthesized oligonucleotides1 µL
    Forward library PCR primer (10 µM)2 µL
    BsmBI3 µL
    Reverse library PCR primer (10 µM)2 µL
    Phusion High-Fidelity PCR Master Mix with HF Buffer25 µL
    H2Oto 30 µL
  3. Amplify reactions in a thermocycler using the following program, varying the total number of cycles for each replicate.
  4. 1 cycle98°C2 min
    8, 10, 12 or 16 cycles98°C10 sec
    60°C15 sec
    72°C45 sec
    1 cycle72°C5 min
    1 cycle4°CHold
  5. Run out the reactions on an ethidium-bromide-stained 2% agarose gel. Visualize the PCR bands using a standard gel imager.
  6. For all reactions yielding a visible product at 92 base pairs, cut out the band using an x-tracta gel extractor tool.
  7. Extract DNA using the Gel Extraction Kit, eluting in 10 µL of water.
  8. Determine the PCR product concentrations using a NanoDrop spectrophotometer. Proceed to Gibson Assembly cloning using the sample amplified for the fewest cycles, with a product concentration >10 ng/µL.
  9. Assemble two replicates of the following Gibson Assembly reaction on ice.
  10. Digested vector from Step B-9100 ng
    Gibson Assembly Master Mix10 µL
    H2Oto 30 µL
  11. Add 1 µL of the library PCR product to one reaction and add 1 µL of water to the other.
  12. Incubate for 1 h at 50°C.
  13. Place reactions on ice after completion.

D. Library Transformation

  1. Warm Recovery Medium for 30 min in a 37°C water bath.
  2. Warm an LB-ampicillin agar plate for 30 min in a 37°C incubator.
  3. Thaw one vial of Endura Electrocompetent Cells and aliquot cells into two tubes on ice for 15 min.
  4. Place two MicroPulser Cuvettes on ice.
  5. For each reaction (control- and insert-containing) proceed as follows:
    1) Add 1 µL of the Gibson Assembly reaction product to bacterial cells.
    2) Transfer 25 µL of the bacterial cell and Gibson Assembly reaction product mixture into cuvettes.
    3) Place cuvette into an Escherichia coli Pulser Transformation Apparatus and electroporate at 1.8 kV.
    4) Quickly add 975 µL of the Recovery Medium into the cuvette and pipette up and down three times to resuspend the cells.
    5) Transfer mixture to a 1.5-mL microcentrifuge tube.
    6) Place the tube in a shaking incubator for 1 h at 37°C.
    7) Serially dilute 10 µL of the transformation mixture in Recovery Medium four times, using a dilution factor of 1/10 at each step.
    8) Spot 10 µL of each dilution onto an LB-ampicillin plate.
    9) Incubate plate overnight at 30°C.
  6. For insert-containing reaction only, proceed as follows:
    1) Seed the remainder of the transformation mixture into a 500-mL Erlenmeyer flask containing 100 mL of LB liquid medium containing 100 µg/mL ampicillin.
    2) Incubate culture overnight at 30°C.
    3) If the transformation efficiency, as assessed by the serial plating, exceeds 20-fold of the library size and the transformation efficiency of the control reaction is <1% of the insert-containing reaction, then prepare plasmid DNA from the bacterial culture using the Plasmid Plus Maxi Kit.
  7. To assess recombination, run out the amplified plasmid on an ethidium-bromide-stained 1% agarose gel. Visualize the plasmid DNA using a standard gel imager.
* For research use only. Not intended for any clinical use.
Quick Inquiry