Pages
Products
Support
CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER

Rapid Modular CAR-T Generation with CRISPR/Cpf1 and AAV Systems Protocol

Experiment Summary

Chimeric antigen receptor (CAR) T cells have recently emerged as powerful players in the arsenal of immune-based cancer therapies. Recently, gene editing technologies have enabled more direct engineering of immune cells. Targeting CARs to the TRAC locus has been shown to enhance CAR-T stability and function. However, current lentiviral, retroviral, or CRISPR/Cas9-based approaches have various limitations in terms of CAR targeting efficiency and modularity, particularly with respect to the generation of multicomponent CAR-T cells. Here, we describe a novel approach, the AAV-Cpf1 KIKO system, which uses a combination of viral and non-viral approaches to efficiently generate stable CAR-T with homologous targeted repair (HDR) knock-in and immune checkpoint knockout in one step.

Experiment Summary

Materials and Reagents

A. Plasmids & DNA

  1. NSL-LbCpf1-NSL mRNA
  2. Plasmids: AAV6/AAV9, PDF6, AAV vector including pXD017, pXD017-39, pXD040, pXD042, pXD043, pXD050, pXD053 and pXD054.

B. Cell lines

  1. Human peripheral blood CD4+ T cells
  2. HEK293T cells
  3. NALM6 cells

C. Kits & Chemicals

  1. X-VIVO 15, serum free hematopoietic cell medium
  2. CD3/CD28 Dynabeads
  3. Polyethyleneimine
  4. Universal Nuclease
  5. QuickExtract DNA Extraction Solution
  6. Taqman assays
  7. T7E1
  8. CD22-Fc
  9. APC-CD4-Clone

Equipment

  1. PCR Thermocycler
  2. Tissue culture hood
  3. 15-cm tissue culture dishes
  4. Retronectin-coated plates
  5. Neon® Transfection System
  6. Pipettes and tips
  7. Next generation sequencing machines
  8. Cell culture incubators (37°C, 5% CO2)
  9. Countess automated cell counter
  10. Plate reader
  11. BD FACSAria II
  12. FlowJo software 9.9.4

Procedure

Construction of AAV vectors

A. crRNA expression vector design and construction

1. Identify genes for knockout by targeted delivery of HDR template.

2. Design LbCpf1 crRNA (20bp).

crTRAC: GAGTCTCTCAGCTGGTACAC

crPDCD1: GCACGAAGCTCTCCGATGTG

3. Synthesize oligonucleotides with two LbCpf1 direct repeat and sticky ends.

4. Digest pXD017 with FD BbsI and insert guide after U6 promoter (pXD017-39).

B. CAR sequence generation

  1. Generation of CD22BBz CAR as previously described 11. CD22 binding scFV (m971) specific for the human CD22 followed by CD8 hinge-transmembrane-regions linked to 4-1BB (CD137) intracellular domains and CD3ζ intracellular domain.
  2. The sequence of CD19 binding scFv (FMC63) was found from NCBI (GenBank: HM852952) and followed by CD8 hinge-transmembrane-regions linked to 4-1BB (CD137) intracellular domains and CD3ζ intracellular domain 12. In order to detect CD19BBz CAR in different way, the Flag-tag sequence (GATTACAAAGACGATGACGATAAG) was added after the CD8⍺ leader sequence.
  3. Synthesize m971-BBz and FMC63-BBz using gBlock (IDT).

C. HDR template design

4. Amplify left and right homologous arms of the TRAC or PDCD1 locus from primary CD4+ T cells by PCR using locus-specific primer sets with multiple cloning site (MCS).

5. Sequence amplicons.

D. AAV-crRNA-HDR-CAR vector cloning

6. pXD040 construction: Clone HDR sequences into the AAV vector (pXD017-39) by Gibson assembly. Incubate samples in a thermocycler at 50°C for 30 minutes.

7. pXD043 (CD22CAR) and pXD054 (CD19CAR) construction: Digest pXD040 with BsiWI and Acc65I, and then clone CAR sequences into MCS by Gibson assembly.

AAV production and titration

A. AAV production

  1. Transfect HEK293FT cells with AAV constructs in 15-cm tissue culture dishes, AAV2 transgene vectors, packaging (pDF6) plasmid, and AAV6/AAV9 serotype plasmid together with polyethyleneimine (PEI).
  2. Collect transfected cells with PBS after 72 hours of transfection.

B. AAV purification and titration

  1. Mix transfected cells with pure chloroform (1/10 volume).
  2. Incubate cells at 37 °C with shake vigorously for 1 h.
  3. Add NaCl to a final concentration of 1 M.
  4. Centrifuge at 20,000g at 4 °C for 15 mins.
  5. Transfer aqueous layer to another tube and discard the chloroform layer.
  6. Add PEG8000 to sample until 10% (w/v) and shake until dissolved.
  7. Incubate mix at 4 °C for 1 h and then centrifuge at 20,000g at 4 °C.
  8. Discard supernatant and suspend pellet in DPBS with MgCl2.
  9. Treat sample with universal nuclease and incubate at 37 °C for 30 mins.
  10. Add chloroform (1:1 volume), shake, and centrifuge at 12,000g at 4°C for 15 mins.
  11. Isolate aqueous layer and concentrate through a 100-kDa MWCO. Critical step: concentrate AAV at high concentration so the volume can be reduced when performing the infection, which can decrease the toxicity of AAV. AAV should be aliquoted and stored at -80 °C.
  12. Titer virus by qPCR using custom Taqman assays targeted to promoter U6.

C. T cell electroporation

  1. Human primary peripheral blood CD4+ T cells were acquired from healthy donors (STEMCELL technologies). T cells were cultured in X-VIVO media with 5% human AB serum and recombinant human IL-2 30U/mL.
  2. Activate T cells with CD3/CD28 Dynabeads for 2 days prior to electroporation.
  3. Use magnetic holder to remove Dynabeads.
  4. Prepare cells at a density of 2 x 105 cells per 10 μL tip reaction or 2 x 106 cells per 100 μL tip reaction in electroporation Buffer R.
  5. Mixed with 1 μg or 10 μg of modified NLS-LbCpf1-NLS mRNA according to reaction volume.
  6. Electric shocked at program 24 (1,600V, 10ms, and three pulses).
  7. Transfer cells into 200 µl or 1 mL of pre-warmed X-VIVO media (without antibiotics) immediately after electroporation.
  8. Add indicated volumes of AAV (AAV volume to not exceed 20% of culture volume) into the T cells 2-4 hours after electroporation. CAR will begin to be expressed after two to three days and have enrichment after stimulation with target cells.

D. CAR-T detection by flow cytometry

  1. After electroporation for 5 days, incubate 1×106 CD22BBz CAR transduced T cells with 0.2 μg CD22-Fc (R&D system) in 100 μL PBS for 30 mins, and then stain with PE-IgG-Fc and FITC-CD3 antibodies for 30 mins.
  2. For CD19BBz CAR detection, incubate CD19BBz CAR transduced T cells with APC-anti-DYKDDDDK Tag and FITC-CD3 antibodies for 30 mins.
  3. Wash cells twice after staining. Quantify and sort labeled cells on BD FACSAria II.
  4. The staining patterns were analyzed using FlowJo software 9.9.4.

E. T7E1 assay

  1. Five days after electroporation, harvest the bulk transduced T cells and sorted T cells. The genomic DNA was collected using the QuickExtract DNA Extraction Solution.
  2. PCR amplify target loci from genomic DNA around cutting site.
  3. PCR amplicons on 2% E-gel EX and purify (with known band size) using Gel Extraction Kit.
  4. After purification, denature 200 ng of purified PCR product, anneal, and digest with T7E1, 37°C 45 min.
  5. Load digested PCR products into 2% E-gel EX and quantify DNA fragment abundance using E-Gel™ Low Range Quantitative DNA Ladder.

HDR quantification and NGS sequencing analysis

  1. Semi-quantitative In-Out PCR
  2. Indel quantification
  3. HDR quantification
  4. Co-culture functional assays

Stable cell line generation

  1. Generate lentivirus including GFP-Luciferase reporter genes.
  2. Infect NALM6 cells with 2x concentrated lentivirus by spinoculation in retronectin-coated plates at 800 g for 45 mins at 32°C.
  3. After infection for 2 days, sort GFP positive cells by flow cytometry.
  4. Perform a second round of sorting after culturing for an additional two days.
  5. Incubate cells with 150 g/ml D-Luciferin and measure bioluminescence signal intensity by an IVIS system to assess luciferase expression.

Cancer cell cytolytic assay (kill assay)

  1. Seed 2104 NALM6-GL cells in a 96 well plate.
  2. Co-culture modified T cells with NALM6-GL at indicated E:T ratios for 24 hours.
  3. Add 150g/ml D-Luciferin into each well and measure luciferase assay intensity by a plate reader to assess cell proliferation.

T cell exhaustion assay

  1. Co-culture T cells modified by AAV with NALM6-GL cells at 0.5:1 E:T ratio for 24 hours.
  2. Collect cells and wash once by DPBS. Incubate cells with 0.2 μg CD22-Fc in 100 μL DPBS for 30 mins.
  3. Stain cells with PE-IgG-Fc, PD-1-FITC, TIGIT-APC and LAG3-Percp/cy5.5 for 30 mins.
  4. Measure-stained cells by flow cytometry.

Intracellular staining of IFNγ and TNF-

  1. After infection for 5 days, co-culture AAV transduced CD22BBz CAR-T cells with NALM6 at 1:1 E:T ratio in fresh media supplemented with brefeldin A and 2 ng/mL IL-2.
  2. After 5 hours of incubation, collect and stain for surface CAR.
  3. Fix and permeabilize cells by fixation/permeabilization solution (BD) and add anti-IFNγ-APC or anti-TNF--FITC for intracellular staining.
  4. After 30 mins, wash stained cells by BD Perm/Wash™ buffer and measure cells by flow cytometry.
* For research use only. Not intended for any clinical use.
Quick Inquiry