Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : CSC-RT0125
Target Gene : GS Host Cell : CHO-K1
Size : >1x106 cells/vial Validation : Sequencing
| Cat. No. | CSC-RT0125 |
| Description | This KO cell line is a stable cell line with a homozygous knockout of GS using CRISPR/Cas9. |
| Target Gene | GS |
| Host Cell | CHO-K1 |
| Host Cell Species | Cricetulus griseus (Chinese hamster) |
| Genotype | GS (-/-) |
| Size | 1x10^6 cells/vial, 1mL |
| Validation | Sequencing |
| Sequencing Primer |
GS-SeqF: CCACCTCAGCAAGTTCCCAC GS-SeqR: CTTTGCGGAAGGGGTCCCG |
| Sequencing Result | Homozygous: 32 bp deletion |
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into a 25 cm2 flask containing pre-warmed media. |
| Media Type | Cell were cultured in RPMI1640 supplemented with 10% fetal bovine serum. |
| Growth Properties | Cells are cultured as a monolayer at 37°C in a humidified atmosphere with 5% CO2. Split at 80-90% confluency, approximately 1:4-1:8. |
| Freeze Medium | Complete medium supplemented with 10% (v/v) DMSO |
| Mycoplasma | Negative |
| Format | One frozen vial containing millions of cells |
| Storage | Liquid nitrogen |
| Safety Considerations |
The following safety precautions should be observed. 1. Use pipette aids to prevent ingestion and keep aerosols down to a minimum. 2. No eating, drinking or smoking while handling the stable line. 3. Wash hands after handling the stable line and before leaving the lab. 4. Decontaminate work surface with disinfectant or 70% ethanol before and after working with stable cells. 5. All waste should be considered hazardous. 6. Dispose of all liquid waste after each experiment and treat with bleach. |
| Ship | Dry ice |
Glutamine synthetase (GS) is a key enzyme in nitrogen metabolism that catalyzes the ATP-dependent conversion of glutamate and ammonia to glutamine. This enzyme plays a crucial role in both prokaryotes and eukaryotes, regulating nitrogen uptake and detoxification. In prokaryotes, especially in bacteria such as Escherichia coli, GS is a central enzyme that helps in the incorporation of inorganic nitrogen into organic molecules, a key step in the synthesis of nucleotides and amino acids. It is tightly regulated through feedback inhibition and covalent modifications, reflecting its importance in cellular metabolism. In eukaryotes, including plants and animals, GS is essential for the regulation of nitrogen balance and cellular homeostasis. In plants, GS participates in the uptake of ammonia produced during photorespiration and the absorption of nitrates, thus playing a key role in the nitrogen cycle.
In mammals, GS is essential for the detoxification of ammonia, especially in the brain and liver. Ammonia is a byproduct of amino acid catabolism and is toxic at high concentrations. In the brain, GS helps convert free ammonia into glutamine, which can then be safely transported to the liver. In the liver, glutamine is converted back to ammonia to produce urea, which aids in the detoxification process. This pathway is critical for preventing hyperammonemia, which can lead to neurological damage and other serious health problems.
Applications of GS Knockout Cell Line - CHO-K1
1. Biopharmaceutical Manufacturing: GS Knockout CHO-K1 cell line is a valuable tool for producing therapeutic proteins and monoclonal antibodies. By knocking out the GS gene, the dependence of cells on glutamine for growth is eliminated, allowing for the production of high-yield, high-quality biologics in a more controlled environment. This can enable more cost-effective and efficient manufacturing processes.
2. Metabolic Engineering Studies: In metabolic engineering, GS Knockout CHO-K1 cells provide an excellent platform for studying metabolic pathways and cellular responses to glutamine deficiency. Researchers can study alternative pathways and regulatory mechanisms activated by cells in the absence of glutamine synthetase activity.
3. Cell Line Development: GS Knockout CHO-K1 cell line facilitates the development of robust and stable cell lines for industrial applications.
4. Nutritional Optimization Studies: Scientists use GS Knockout CHO-K1 cells to optimize nutrient formulations in cell culture media. By understanding how cells adapt to glutamine deprivation, researchers can develop improved media formulations to enhance cell growth, protein expression, and overall productivity.
5. Drug Development and Toxicity Testing: These cell lines are used in drug development to screen potential drug candidates and their effects on cell metabolism and viability. The loss of GS activity can mimic certain pathological states, making them useful for specific toxicity testing and drug efficacy studies.
6. Gene Regulation and Functional Genomics: GS Knockout CHO-K1 cells are a model system for studying gene regulation, functional genomics, and synthetic biology applications. Researchers can use these cells to study the role of other genes and pathways that interact with or compensate for the loss of glutamine synthetase.
A: RPMI1640 supplemented with 10% fetal bovine serum. <br> It is not required to add the selection antibiotics when culturing the KO cells.
A: The knockout cell product is validated by PCR amplification and Sanger Sequencing to confirm the mutation at the genomic level. Please find the detailed mutation info in the datasheet.
A: Single clonal cell.
A: No. This knockout cell product is generated using the CRISPR/Cas9 system to induce small insertions or deletions (indels) resulting in frameshift mutations. Although these frameshift mutations typically disrupt the coding gene, there is a possibility that the non-functional transcript may still be transcribed. Consequently, this could potentially yield misleading results when analyzed by RT-qPCR.
A: The cell line should be stored in liquid nitrogen for long-term preservation.
A: For most cases, we often keep at least 2 clones with different frameshift mutations. Please feel free to contact us to check if there are additional available clones.
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
GS Knockout Cell Line-CHO-K1 has become an indispensable asset in my lab, significantly advancing our understanding of gene function and its role in various biological processes.
The straightforward and well-optimized protocol of GS Knockout Cell Line-CHO-K1 has streamlined my workflow, saving me valuable time and resources.
The consistent and reproducible results I've obtained with GS Knockout Cell Line-CHO-K1 have bolstered the reliability of my research findings.
I deeply appreciate the high-quality formulation of GS Knockout Cell Line-CHO-K1, which ensures its stability and long shelf life, allowing me to plan experiments with confidence.
The remarkable efficiency of GS Knockout Cell Line-CHO-K1 has opened up new avenues for experimentation and has accelerated the pace of my research progress.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.