Cat.No. : CSC-RT0125
Host Cell: CHO-K1 Target Gene: GS
Size: 1x10^6 cells/vial, 1mL Validation: Sequencing
| Cat. No. | CSC-RT0125 |
| Description | This KO cell line is a stable cell line with a homozygous knockout of GS using CRISPR/Cas9. |
| Target Gene | GS |
| Gene ID | 100689337 |
| Genotype | GS (-/-) |
| Host Cell | CHO-K1 |
| Host Cell Species | Cricetulus griseus (Chinese hamster) |
| Size | 1x10^6 cells/vial, 1mL |
| SequencingResult | Homozygous: 32 bp deletion |
| Sequencing Primer | GS-SeqF: CCACCTCAGCAAGTTCCCAC GS-SeqR: CTTTGCGGAAGGGGTCCCG |
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into a 25cm2 flask containing pre-warmed media. |
| Media Type | Cell were cultured in RPMI1640 supplemented with 10% fetal bovine serum. |
| Growth Properties | Cells are cultured as a monolayer at 37°C in a humidified atmosphere with 5% CO2. Split at 80-90% confluency, approximately 1:4-1:8. |
| Freeze Medium | Complete medium supplemented with 10% (v/v) DMSO |
| Mycoplasma | Negative |
| Format | One frozen vial containing millions of cells |
| Storage | Liquid nitrogen |
| Safety Considerations |
The following safety precautions should be observed. 1. Use pipette aids to prevent ingestion and keep aerosols down to a minimum. 2. No eating, drinking or smoking while handling the stable line. 3. Wash hands after handling the stable line and before leaving the lab. 4. Decontaminate work surface with disinfectant or 70% ethanol before and after working with stable cells. 5. All waste should be considered hazardous. 6. Dispose of all liquid waste after each experiment and treat with bleach. |
| Ship | Dry ice |
A: RPMI1640 supplemented with 10% fetal bovine serum.
It is not required to add the selection antibiotics when culturing the KO cells.
A: The knockout cell product is validated by PCR amplification and Sanger Sequencing to confirm the mutation at the genomic level. Please find the detailed mutation info in the datasheet.
A: Single clonal cell.
A: No. This knockout cell product is generated using the CRISPR/Cas9 system to induce small insertions or deletions (indels) resulting in frameshift mutations. Although these frameshift mutations typically disrupt the coding gene, there is a possibility that the non-functional transcript may still be transcribed. Consequently, this could potentially yield misleading results when analyzed by RT-qPCR.
A: The cell line should be stored in liquid nitrogen for long-term preservation.
A: For most cases, we often keep at least 2 clones with different frameshift mutations. Please feel free to contact us to check if there are additional available clones.
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
GS Knockout Cell Line-CHO-K1 has become an indispensable asset in my lab, significantly advancing our understanding of gene function and its role in various biological processes.
The straightforward and well-optimized protocol of GS Knockout Cell Line-CHO-K1 has streamlined my workflow, saving me valuable time and resources.
The consistent and reproducible results I've obtained with GS Knockout Cell Line-CHO-K1 have bolstered the reliability of my research findings.
I deeply appreciate the high-quality formulation of GS Knockout Cell Line-CHO-K1, which ensures its stability and long shelf life, allowing me to plan experiments with confidence.
The remarkable efficiency of GS Knockout Cell Line-CHO-K1 has opened up new avenues for experimentation and has accelerated the pace of my research progress.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.
Our promise to you:
Guaranteed product quality, expert customer support.
24x7 CUSTOMER SERVICE
CONTACT US TO ORDER
Copyright © Creative Biogene. All rights reserved.
