Pages
Products
Support
CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER

Virus Binding and Internalization Protocol for Adeno-associated Virus

Experiment Summary

The binding and internalization of adeno-associated virus (AAV) is an important determinant of viral infectivity and tropism. The ability to dissect these two tightly connected cellular processes would allow better understanding and provide insight on virus entry and trafficking. In the following protocol, we describe a quantitative PCR (qPCR) based method to determine the amount of vector bound to the cell surface and the amount of subsequent virus internalization based on viral genome quantification. This protocol is optimized for studying AAV. Nevertheless, it can serve as a backbone for studying other viruses with careful modification.

Materials and Reagents

  1. 12-well tissue culture (TC) treated plates
  2. GeneMate 1.7 ml microcentrifuge tubes
  3. Tips
  4. Lightcycler 96-well qPCR plates
  5. Cell lifter
  6. HeLa cells
  7. Purified single-stranded AAV (any serotype)
  8. 1x PBS
  9. DNeasy Blood and Tissue Kit
  10. Molecular grade water
  11. DMEM
  12. Trypsin-EDTA
  13. Fetal bovine serum (FBS)
  14. 100x penicillin/streptomycin
  15. FastStart Essential DNA Green Master Mix
  16. Virus-specific qPCR primers
    fLuc-F – AAAAGCACTCTGATTGACAAATAC
    fLuc-R – CCTTCGCTTCAAAAAATGGAAC
  17. Human genomic qPCR primers
    hLB2C1-F – GTTAACAGTCAGGCGCATGGGCC
    hLB2C1-R – CCATCAGGGTCACCTCTGGTTCC
  18. 10 ng/μl CBA-fLuc plasmid stock solution
  19. 100 ng/μl HeLa genomic DNA stock solution

Equipment

  1. Pipette
  2. Biosafety cabinet
  3. CO2 tissue culture incubator
  4. Tabletop centrifuge
  5. Lightcycler 96 qPCR instrument
  6. PCR plate microcentrifuge

Procedure

A. Cell preparation for virus binding and internalization assay

  1. Seed 12-well TC plate with 1e5 HeLa cells/well (Figure 1), bringing the well to a final volume of 1 ml. Allow 4-6 h for the cells to fully adhere to the plate at 37 °C in 5% CO2 in a tissue culture incubator.
  2. Incubate cells at 4 °C for 30 min.
  3. Infect cells with AAV at a multiplicity of infection (MOI) of 1e3 vector genomes per cell (vg/cell) by carefully pipetting virus into the meniscus of the media near the edge of the well, taking care not to scrape the well surface. Slowly rock the plate by hand several times to mix.
  4. Incubate cells at 4 °C for 1 h to allow virus to bind to the cell surface.
  5. Wash cells gently 3 times with 400 µl ice-cold PBS to remove unbound virus by tilting the plate towards you and adding PBS very slowly to the edge of the well with a pipette.

Example of experimental plate setup.Fig. 1 Example of experimental plate setup.

B. Binding (1 well)

  1. Add 200 µl PBS to each well.
  2. Scrape off the cells and transfer them to a 1.7 ml microcentrifuge tube.
  3. Isolate total DNA using a QIAGEN DNeasy Blood and Tissue Kit, following manufacturer instructions with the following exception: use 50 µl of molecular grade water to elute sample from the column.

C. Internalization (1 well)

  1. Carefully add 1 ml fresh complete DMEM, pre-warmed to 37 °C, to the cells by tilting the plate towards you and adding very slowly to the edge of the well with a pipette.
  2. Incubate at 37 °C in 5% CO2 in a tissue culture incubator for 1 h to allow for virus internalization.
  3. Remove the media by aspiration and treat the cells with 1 ml trypsin to detach them from the plate and to remove surface bound virions that did not internalize.
  4. Transfer the trypsinized cells to a 1.7 ml microcentrifuge tube and pellet cells by centrifuging at 500 x g for 3-5 min at room temperature.
  5. Carefully remove trypsin without disturbing the cell pellet.
  6. Wash the cell pellet 3 times by resuspending the cells in 200 µl PBS, pelleting by centrifugation 500 x g for 3-5 min, and carefully removing the PBS.
  7. After the final PBS wash, resuspend the cell pellet in 200 µl PBS.
  8. Isolate total DNA using a DNeasy Blood and Tissue Kit.

D. qPCR quantification

  1. fLuc transgene (or transgene of choice)

1) Generate standard curve for vector genome quantitation using plasmid containing the CBA-fLuc transgene.

2) Prepare master mix (Table 1) for n + 1 reactions (with n being the total number of reactions).

Table 1. qPCR master mix

qPCR master mix

3) Load 8 µl master mix in each well.

4) Load 2 µl of each sample, including standard curve.

5) Spin the plate in a microplate centrifuge for 30-60 sec at room temperature to assure samples are at the bottom of the wells.

6) Run the qPCR using the corresponding program in Table 2.

Table 2. qPCR cycling parameters

qPCR cycling parameters

2. hLB2C1 genomic gene

1) Generate standard curve for cellular genome quantitation using pre-prepared HeLa cell isolated DNA.

2) Prepare master mix (Table 1) for n + 1 reactions (with n being the total number of reactions).

3) Load 8 µl master mix in each well.

4) Load 2 µl of each sample, including standard curve.

5) Spin the plate in a microplate centrifuge for 30-60 sec at room temperature to assure samples are at the bottom of the wells.

6) Run the qPCR using the corresponding program in Table 2.

E. Data analysis

* For research use only. Not intended for any clinical use.
Quick Inquiry