Pages
Products
Support
CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER

Ex vivo Culture and Lentiviral Transduction Protocol of Benign Prostatic Hyperplasia (BPH) Samples

Experiment Summary

To assess oncogenic potential, classical transformation assays are based on cell line models. However, cell line-based models do not reflect the complexity of human tissues. Therefore, an inducible expression system was developed for gene expression in ex vitro human tissues that maintain native tissue architecture, such as epithelia and stroma. To validate the system, known tumor suppressors (p53, p33ING1b), oncoproteins (RasV12, p47ING3) or controls (empty vector, YFP) were transduced and expressed in ex vitro prostate tissues and then proliferation was assessed by immunohistochemical markers (H3S10phos). This protocol describes how to generate lentiviral vectors and particles, successfully transduce human prostate tissue, induce exogenous gene expression, and assess cell proliferation.

Materials and Reagents

A. Lentiviral vector generation

pLVX Lenti-X Tet-One inducible expression system, FWDseq: taaaccagggcgcctataaa, REVseq: taggcagtagctctgacggc, BamHI, EcoRI, Calf Intestinal Alkaline Phosphatase, Hi-fidelity DNA polymerase for PCR amplification, In-Fusion HD enzyme, QIAquick gel extraction columns, Ampicillin 100 mg/ml (dissolved in ddH2O and filtered sterilized), Small-scale plasmid DNA purification QIAprep Spin Miniprep kit, Large-scale plasmid DNA purification Maxi kit, Yeast extract, Tryptone, NaCl, 2YT media.

B. Lentiviral particules packaging

Syringe, 0.45 μm filters, 100 mm culture dishes, Amicon Ultra-15, HEK293T cell line, Packaging plasmids (pMD2.G and psPAX2) to be transformed and purified, Transfection reagent TransIT-LT1, Dulbecco's Modified Eagle's Medium.

C. Lentiviral particules transduction and titration

6-well culture plates, LNCaP cell line, RPMI-1640 media, 200 mM L-glutamine, Fetal calf serum, Hexadimethrine bromide, Puromycin dihydrochloride, Crystal violet, Induction of gene expression, 10% ethanol, Monoclonal ANTI-FLAG M2-Peroxidase (HRP) antibody, Doxycycline, 4% formalin.

D. Ex vivo tissue preparation and transduction

Scalpels or surgical blades, Hydrophobic pen, 100% ethanol, Media, Gelatin sponges, Antimycotic solution, 10 μg/ml hydrocortisone, 10 μg/ml insulin solution from bovine pancreas, Hexadimethrine bromide, Doxycycline, Bovine Serum Albumin, HRP-conjugated secondary antibodies, ImmPRESSTM HRP Anti-Rabbit IgG, ImmPRESSTM HRP Anti-mouse IgG, ImmPACT DAB Peroxidase (HRP) Substrate, Xylene, DPX mounting media, Tetracycline-free FBS, Immunohistochemistry staining for proliferation markers, Primary antibodies for proliferation markers: H3S10phos, Antigen Retrieval Buffer (100x Citrate Buffer pH 6.0), NaHCO3, MgSO4, Hematoxylin, Scott's tap water substitute, Gill's Hematoxylin II solution.

Equipment

1. Pipettes

2. PCR instrument

3. CO2 incubator

4. Decloaker

5. Microtome to slice paraffin blocks

6. Freezer

7. Shaker

Procedure

A. Lentiviral vector generation (Timing 1-2 weeks)

1. Amplify by PCR the gene(s) of interest to insert in pLVX using gene-specific primers:

Fwd ccctcgtaaaGAATTC xxx xxx xxx xxx xxx xxx xxx

Fwd cgactacgccGGATCC xxx xxx xxx xxx xxx xxx xxx if using pLVX-FLAG/HA

Rev ccctcgtaaaGAATTC yyy yyy yyy yyy yyy yyy yyy

Assemble PCR reaction:

2. Template DNA 0.1 μg

Platinum PCR SuperMix 45 μl

2 μl of Fwd primer 10 μM

2 μl of Rev primer 10 μM

Add ddH2O to a final volume of 50 μl

3. Run PCR programme:

Denature 5 min at 95 °C

25 cycles:

Denature - 30 s at 95 °C

Anneal - 30 s at 55 °C

Extend - 1 min per 1,000 bp of PCR product at 68 °C

Final extension at 68 °C

Ramp down to 4 °C and keep at 4 °C indefinitely

4. Linearise pLVX (or pLVX-FLAG/HA available upon request) by digesting 2-10 μg purified plasmid with BamHI and EcoRI (or only BamHI if using pLVX-FLAG/HA) for 30-60 min at 37 °C. Then, gel purify by running on 1% agarose gel, cutting the ~9,300 bp fragment, dissolve in 600 μl QIAGEN solubilization buffer, apply on column, spin for 1 min at maximum speed, remove filtrate, wash with 700 μl QIAGEN wash buffer, spin for 1 min at maximum speed, remove filtrate, spin one last time for 1 min at maximum speed, apply 50 μl 50 μM Tris-Cl pH 7.5 elution buffer, let sit for 2-5 min, spin for 1 min at maximum speed, remove column, and retain purified pLVX linearised plasmid DNA.

5. Insert the PCR product into the pLVX vector by recombination with In-Fusion HD enzyme.

6. Transform competent DH5α bacterial cells using standard procedures.

7. Purify DNA using QIAprep Spin Miniprep kit.

8. Transform positive clones in DH5α. Pick a colony in the morning, inoculated 2 ml 2YT media (supplemented with 100 μg/ml ampicillin), incubate in a shaker (200-250 rpm) at 37 °C for about 6-8 h, then scale up to 250 ml 2YT media (supplemented with 100 μg/ml ampicillin), and return to shaker (200-250 rpm) at 37 °C overnight.

9. Purify plasmid DNA.

B. Lentiviral particules packaging (Timing 5 days)

1. The day before transfection, seed 2-3 million HEK293T cells in 100 mm dishes (1 for each pLVX construct) in 10 ml complete DMEM.

2. The next day, prepare for each pLVX construct to transfect, 1 ml of serum-free media and 54 μl of LT1 reagent. Incubate the media-LT1 mixture at room temperature for 15 min. During that time, mix 9 μg pLVX with 6.75 μg psPAX2 and 2.25 μg pMD2.G. Add 1 ml of the media-LT1 mixture to the DNA and further incubate for 30 min at room temperature. Retrieve the HEK293T dishes from the incubator and add the media-LT1-DNA mixture dropwise to the cells. Return the HEK293T dishes to the incubator and leave overnight (12-18 h). The next day, remove the media (~10 ml) and replace with 5-6 ml of fresh DMEM (with supplements such as FBS, glutamine, and antibiotics).

3. After 24 h and 48 h, collect the media (which contains the lentiviral particules - viral supernatant), replenish with 5-6 ml fresh DMEM and store in a refrigerator. Once the viral supernatants are collected, the viruses should be filtered (essentially to remove floating HEK293T cells) using a syringe and a 0.45 μm filter.

C. Lentiviral transduction and titration (Timing 5 days)

1. On Day 0, seed LNCaP cells at 100,000 cells per well of a 6-well plate.

2. On Day 1, add lentiviral particules to each well following a serial dilution scheme [e.g., 2,000 μl (dilution factor 1), 200 μl (10), 20 μl (1 x 102), 2 μl (1 x 103), 0.2 μl (1 x 104), and a 0 μl not transduced control]. The viral particules are left on the cells overnight (about 18 h).

3. On Day 2, remove the lentivirus-containing media and replace with fresh complete RPMI-1640 media.

4. On Day 3, add puromycin to each well at a 1 μg/μl final concentration.

5. On Day 5, remove the media and fix and stain the cells using 1% crystal violet dissolved in 10% ethanol (enough to cover the plate). Wash the stain several times with distilled water and count colonies. The multiplicity of infection (MOI) is estimated using the following formula:

MOI = colony number X viral dilution factor

D. Ex vivo tissue preparation and transduction (Timing 1-2 weeks)

1. Benign prostatic hyperplasia (BPH) samples are obtained from cancer-free patients. BPH samples are placed in enough ice cold RPMI1640 media without supplements to cover the specimen.

2. Within 24 h from the surgery, dissect tissues to 1 mm3 pieces and culture in duplicates on gelatin sponges  pre-soaked in culture media supplemented with 1x antimycotic solution, 10 μg/ml hydrocortisone, and 10 μg/ml insulin solution from bovine pancreas, doxycycline, and lentiviral particules.

3. At the termination of the experiments (24-72 h), immediately place the samples in 4% formalin for 24 h, then process in ethanol, followed by xylene, and finally paraffin embedding.

4. Pause Point: Once fixed and embedded in paraffin, the ex vivo tissues can be stored at room temperature indefinitely.

E. Immunohistochemistry staining for proliferation markers (Timing 2 days)

1. Slice formalin fixed paraffin embedded tissues and then bake at 60 °C for 2 h.

2. Deparaffinize the tissues by incubation in three consecutive pots of xylene for 5 min each.

3. Hydrate the tissues by sequential incubation for 1 min in 100% ethanol three times followed by 95% ethanol, 70% ethanol, 50% ethanol, and finally water.

4. Retrieve antigens in citrate buffer in a decloaker at 125 °C for 30 s.

5. Inactivate endogenous peroxidase by incubating cooled slides in 3% H2O2 solution for 10 min, then wash slides in water and block non-specific protein binding sites by a 10 min incubation in 1% BSA in TBS. Use a hydrophobic pen (DAKO) to mark around the tissue.

6. Incubate the slides in primary antibody diluted in 1% BSA 200 µl per section overnight at 4 °C in a wet chamber.

7. Wash the slides twice in TBS for 5 min with gentle agitation.

8. Incubate the slides in HRP-conjugated secondary antibodies (ImmPRESSTM HRP Anti-Rabbit IgG; ImmPRESSTM HRP Anti-mouse IgG) for 30 min.

9. Wash off the unbound antibody by a 10 min wash in running tap water.

10. Incubate the slides in a 1x working solution of DAB (ImmPACT DAB Peroxidase Substrate SK-4105) for 5 min followed by a 5 min water wash.

11. Counter-stain nuclei with Gill's Hematoxylin II for 15 s followed by a water wash and 30 s incubation in Scott's water followed by a water wash.

12. Dehydrate tissues by 1 min sequential immersions in 50% ethanol, 70% ethanol, 95% ethanol, and three times 100% ethanol.

13. Incubate the slides in three consecutive containers of xylene for 3 min.

14. Mount the slides in DPX and leave to dry for 24 h.

15. Observe the slides under a microscope (optical) or scan on the Aperio.

16. The staining can be scored automatically using the Aperio imaging system.

* For research use only. Not intended for any clinical use.
Quick Inquiry