Pages
Products
Support
CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER

Protocol on Respiratory Syncytial Virus Infection in Mice and Detection of Viral Genomes in the Lung Using RT-qPCR

Experiment Summary

Respiratory syncytial virus (RSV) is a single-stranded negative sense RNA virus that belongs to the paramyxovirus family. RSV infections lead to a variety of clinical outcomes ranging from a mild "cold-like disease" to death. Infection is usually more severe in infants and the elderly. RSV is associated with the development and exacerbation of chronic lung conditions including asthma, and it is a major cause of hospitalizations in infants. Because of its clinical relevance, experimental animal models to study RSV in vivo are needed. The most common and accessible animal model in research laboratories is the mouse. However, commonly use RSV strains poorly establish infection in mice and thus titration of the virus from mouse lungs to confirm infection is not sensitive enough to detect early viral infection. Here we discuss in detail how to infect BALB/c mice with RSV and how to detect RSV genomes in the lung using reverse transcription quantitative PCR (RT-qPCR). This method allows detection of viral genomes as early as day 1 post-infection (shown in Figure 2), whereas traditional TCID50 fails to detect significant virus until after day 2 post-infection. Of note, despite of higher sensitivity, genome RT-qPCR only shows the production of viral genomes and thus positive results for this assay are not proof of production of infectious viral particles.

Materials and Reagents

  1. Vacuum-driven Sterilcup® 500 ml Millipore ExpressPLUS 0.22 μm PES
  2. FastPrep® tubes
  3. ¼" ceramic sphere
  4. CryoTubesTM vials for freezing viruses
  5. Surgical scissors
  6. Tweezers
  7. 384-well PCR plate
  8. PCR strip tubes, 0.2 ml
  9. 0.22 μm filter used in the pipette aid
  10. BSL2 personal protective equipment (PPE)
  11. Mice (Balb/c, 6-8 weeks old, gender-mixed)
  12. Respiratory syncytial virus
  13. SYBR green master mix
  14. qPCR primer sets
    qPCR primer sets
  15. RSV genome RT primer: 5'GATAAATATAGGCATGGGGAAAGTG3'
  16. TRIzol reagent
  17. Chloroform
  18. Isopropanol
  19. Ultra-Pure nuclease-free water
  20. SuperScript® III First-Strand Synthesis System
  21. High capacity RNA-to-cDNATM kit
  22. Ketamine
  23. Phosphate buffered saline (PBS)
  24. Ketamine solution
  25. Primer preparation

Equipment

  1. Biosafety hood in biosafety level 2 facility
  2. Applied Biosystem ViiATM 7 LightCycler
  3. Centrifuge
  4. Spectrophotometer
  5. Thermal cycler
  6. MP Fastprep-24 homogenizer

Procedure

A. Infection (Figure 1)

  1. Dilute RSV stock [for preparation of RSV stocks see Sun and López (2016)] in sterile PBS to a concentration of 5 x 106 TCID50 / 35 μl. Keep the diluted virus on ice.
  2. Anesthetize the mice with 40 μl/20 g of weight of Ketamine solution. Make sure each mouse is completely asleep and unresponsive to a toe pinch stimulus.
  3. Hold the mouse vertically with the head tilted back and slowly deliver 35 μl of virus dilution into its nostrils using a 100 μl pipette. The solution should be completely aspirated into the lung and not be swallowed through the mouth.
  4. Place the mouse back into its cage and monitor it until it wakes from anesthesia.

Fig. 1 Procedure for intranasal immunization of mice.Fig. 1 Procedure for intranasal immunization of mice.

B. Lung tissue collection

5. Prepare collection tubes: For each sample, add 1 ml TRIzol into one MP Fastprep tube containing one ceramic sphere. Other similar homogenizing techniques can be used.

6. Euthanize the mice at the desired time point post infection (usually 6 h, 10 h, 24 h, and daily for up to one week) using CO2 or other approved method.

7. Place a dead mouse on polystyrene foam and pin each limb with needles, belly up.

8. Spray the fur of the mouse using 70% ethanol.

9. Use scissors to cut open the abdominal and thoracic cavities. Opening the abdominal cavity exposing the underside of the diaphragm. Use scissors to pierce through the diaphragm. Cut away the ribcage of the mouse and fully expose the heart and lungs. Collect two of the left lobes and place into a Fastprep tube containing TRIzol. Always take the same lobes of the lung to maintain consistency. Other lobes can be used for other purposes.

10. Homogenize the lung on the FastPrep-24 homogenizer or similar equipment. Homogenize for 20 sec. Repeat three times.

11. Aliquot the homogenized samples into 500 μl aliquots. Place them at -80 °C for storage.

C. Total RNA extraction

12. Thaw one aliquot and add 500 μl of fresh TRIzol for a 1 ml total volume.

13. Add 200 μl of chloroform and shake vigorously for 15 sec.

14. Leave for 3 min at room temperature to allow for phase separation. Centrifuge for 15 min at 12,800 x g in a microcentrifuge at 4 °C.

15. Carefully collect 3/4 of the upper aqueous phase without disturbing or touching the interface or organic layer. Combine the aqueous phase with an equal volume of isopropanol. Gently invert to mix.

16. Leave for 10-20 min at -20 °C for precipitation.

17. Centrifuge for 15 min at 12,800 x g in a microcentrifuge at 4 °C.

18. Discard the supernatant with care not to lose the pellet.

19. Wash the pellet with 1 ml of 75% ethanol. Vortex briefly or pipette up and down the sample multiple times.

20. Centrifuge for 10 min at 12,800 x g in a microcentrifuge at 4 °C.

21. Remove the supernatant and invert the tubes. Allow the pellet to air-dry until clear.

22. Resuspend the pellet in 30-40 μl of ultra-pure nuclease-free dH2O.

23. Incubate at 65 °C for 5 min.

24. Measure RNA concentration in a Nanodrop 1000 or equivalent.

D. Reverse transcription (RT)

D1. RT of total mRNA (T-cDNA)

25. Use 2 μg of RNA for reverse transcription.

26. Prepare the RT reaction mix in PCR tubes on ice using the High Capacity RNA-cDNA kit as follows (per sample): 2x RT buffer 5 μl, 20x RT Enzyme mix 0.5 μl, RNA 2 μg, nuclease-free H2O quantity sufficient to 10 μl.

27. Gently mix and briefly centrifuge to collect all the components at the bottom of the tube.

28. Place into a BioRad C1000 Thermal Cycler and run program to synthesize cDNA as follow: 37 °C for 60 min, 95 °C for 5 min, 4 °C hold.

29. Store total cDNA (T-cDNA) at -20 °C until ready for qPCR analysis.

D2. RT of viral genomes (V-cDNA)

30. Use 2 μg of RNA for reverse transcription.

31. Mix the following ingredients per sample in one tube: 1 μl of the genome RT primer (50 μM), 1 μl of dNTPs (10 mM), 2 μg of RNA, nuclease-free H2O (add up to 10 μl).

32. Incubate 10 min at 65 °C.

33. Prepare the RT reaction mix in the PCR tubes on ice using SuperScript® III First-Strand Synthesis System as follows (per sample): 5x RT buffer 2 μl, 25 mM MgCl2 4 μl, 0.1 M DTT 2 μl, RNase OUT 1 μl, SS III 1 μl.

34. After incubation, add 10 μl of RT mix to each sample. Mix well.

35. Incubate at 50 °C for 50 min.

36. Heat at 85 °C for 5 min.

37. Add 1 μl of RNase H per sample (from SuperScript III reverse transcriptase kit) and incubate at 37 °C for 20 min.

38. Keep the viral genome cDNA (V-cDNA) at -20 °C until ready for the qPCR analysis.

E. Quantitative PCR (qPCR)

39. qPCR reactions are performed in triplicate using specific primers and the Power SYBR® Green PCR Master Mixture in a Viia7 Applied Biosystem Lightcycler or equivalent.

40. Thaw both T- and V-cDNA and spin down before use.

41. Dilute cDNA 1:40 using dH2O.

42. Load the plate with 4 μl of the diluted cDNA/well in triplicate.

43. Prepare Master Mix: SYBR green (5 μl) with 1 μl of qPCR primer mix. Load the plate with Master Mix 6 μl/well. For housekeeping genes, Rsp11 and α-tubulin are examined as reference using T-cDNAs as template. For RSV genome, RSV g primer pair is used and V-cDNAs serve as template.

44. Run the qPCR using the following program (Table 1):

Table 1. DI-PCR program

Table 1. DI-PCR program

45. Viral genome copy numbers are normalized based on levels of Rsp11 and α-tubulin for mouse samples using the formula: relative copy number=2,500*1.93^ (Ctgenome - hki), hki=median of CtRsp11 and Ctα-tubulin. Sequences of primers used for qPCR can be found in the materials under qPCR primers. Results see Figure 2.

Figure 2. RSV viral genome qPCR.Figure 2. RSV viral genome qPCR.

* For research use only. Not intended for any clinical use.
Quick Inquiry