Pages
Products

pFLAG-CMV2 vector

For research use only. Not intended for any clinical use.
Cat.No.
VET1147
Promoter
CMV
Selection
Ampicillin
Source
mammalian cells, Escherichia coli
Species
Bacterial
Tag
N-Flag

Background

Case Study

Applications

Publications

Q & A

Customer Reviews

The pFLAG-CMV2 vector is highly versatile in biological research and biotechnology due to its range of functionalities. Most conspicuously, it is typically employed in the field of protein expression studies. The incorporated promoter (CMV) in this plasmid enables the attached gene to fire, resulting in the high production of the protein coded by the gene of interest. This accentuated protein expression facilitates ease of study and analysis, making the pFLAG-CMV2 vector an invaluable tool in protein research. The vector carries three different origins of replication (pBR322 ori, F1 ori, SV40 ori). This feature enhances the versatility of the pFLAG-CMV2 vector, enabling scientists to use the vector across a diversity of organisms and cell types. Another salient feature of the pFLAG-CMV2 is the presence of an N-Flag tag. The addition of this tag allows researchers to locate and isolate the protein of interest. The plasmid carries resistance to ampicillin (Amp), which aids in the selection of successfully transformed cells. Only the cells that have taken up the plasmid survive in an ampicillin-containing medium, hence simplifying the identification and selection process.

The nuclear protein HMGB1 is secreted in response to various stimuli and functions as a danger-associated molecular pattern.However,the mechanism of HMGB1 secretion remains largely unknown.Here,we investigated the role of secretory autophagy machinery and vesicle trafficking in HMGB1 secretion.The researchers observed that HSP90AA1(heat shock protein 90αfamily class A member 1),a stress-induced protein,regulates HMGB1 translocation from the nucleus to the cytoplasm and its secretion through direct interactions.Furthermore,geldanamycin,an HSP90AA1 inhibitor,reduced HMGB1 secretion.Secretion of HMGB1 is inhibited by early autophagy inhibitors and is reduced in ATG5-deficient cells even when GORASP2 is overexpressed.In contrast,late autophagy inhibitors increased HMGB1 secretion under the same conditions.The multivesicular body formation inhibitor GW4869 significantly reduces HMGB1 secretion under HMGB1 secretion-inducing conditions.Therefore,this study demonstrates that secretory autophagy and multivesicular body formation mediate HMGB1 secretion.

In this study,the pFLAG-CMV2 vector purchased from Creative Biogene was involved in the subcloning of HSP90AA1.cDNA of HSP90AA1 was subcloned into the pFlag CMV2 plasmid(Creative Biogene,VET1147).The HSP90AA1 domain mutants NTD(a.a.1–271),MD(a.a.272–629),and CTD(a.a.630–732)were inserted into the pFlag TOPO plasmid.

Figure 1. HSP90AA1 interacts with HMGB1.Figure 1.HSP90AA1 interacts with HMGB1.(Kim Y H,et al.,2021)

The pFLAG-CMV2 vector is commonly used in molecular biology and biotechnology for a variety of applications. Some of these applications include: Protein Expression: The pFLAG-CMV2 vector is a popular tool for producing recombinant proteins in mammalian cells. The vector includes the CMV promoter, which drives robust expression of your gene of interest with an N-terminal FLAG tag. Tagging and Purification: The pFLAG-CMV2 vector is often used for tagging proteins with the FLAG epitope. Flag-tagging is a method used to attach a small molecular weight epitope to a protein using recombinant DNA technology. The FLAG-tagged proteins can then be easily purified and detected using anti-FLAG antibodies. Protein Localization Studies: By creating a fusion protein with FLAG epitope, the pFLAG-CMV2 vector can help in studying the cellular localization of proteins. Interaction Studies: The FLAG-tag in the vector can be utilized to study protein-protein and protein-DNA interactions. The tagged protein can be immunoprecipitated using anti-FLAG antibodies and the bound proteins or DNA can be identified. Functional Studies: The pFLAG-CMV2 vector can be used to express the gene of interest in various cell types to study its function. It allows for overexpression of the protein to further examine its role in biological processes.
Publications
  1. Kim Y H, Kwak M S, Lee B, et al. Secretory autophagy machinery and vesicular trafficking are involved in HMGB1 secretion[J]. Autophagy, 2021, 17(9): 2345-2362.
Customer Q&As
What is the pFLAG-CMV2 vector?

A: pFLAG-CMV2 is a mammalian cell plasmid with ampicillin resistance that is used to overexpress protein.

What types of replicators does the pFLAG-CMV2 vector employ?

A: The pFLAG-CMV2 vector contains three types of replicators: pBR322 ori, F1 ori, and SV40 ori.

What are the 5' and 3' sequencing primers used for the pFLAG-CMV2 vector?

A: The 5' sequencing primer for the pFLAG-CMV2 vector is CMV-F: CGCAAATGGGCGGTAGGCGTG and the 3' sequencing primer is hGH-pA-R: CCAGCTTGGTTCCCAATAGA.

What kind of plasmid is the pFLAG-CMV2 vector?

A: The pFLAG-CMV2 vector is a mammalian cell carrier and protein overexpression plasmid.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Customer Reviews
Simplifying genetic research

I appreciate how the pFLAG-CMV2 vector simplifies gene studies. Its design, incorporating the powerful CMV promoter, facilitates easy isolation and detection of a target protein, which can expedite experimental results.

United Kingdom

02/27/2022

Flexibility

The pFLAG-CMV2 vector is impressively versatile. It works perfectly with various gene types and host cells, offering flexibility in creating the necessary genetic constructs.

Canada

05/10/2020

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction

CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER
Quick Inquiry

Inquiry