Tel: 1-631-626-9181 (USA)   44-207-097-1828 (Europe)
  Email:

pEZX-AM03-mmu-mir-344h-1

Cat.No.
MIPMS3678
Description
Mus musculus mir-344h-1 stem-loop
Reporter
mCherry
Selection Marker
Hygromycin
Size/Form
purified plasmid or bacterial stock
Species
Mouse
Storage
Typically ships in 3-4 weeks
Vector Type
plasmid
miRNA Information
Precursor Accession No.
MI0019196
Precursor Name
mmu-mir-344h-1
Precursors sequence
CAGGCUUCUGGCUAUAUUCCAGGACAUACCUGGUC CUGGGUAUAACCAAAGCCCGACUGU
Mature miRNA-1 Accession No.
MIMAT0022383
Mature miRNA-1 Name
mmu-miR-344h-5p
Mature miRNA-1 sequence
CAGGCUUCUGGCUAUAUUCC
Mature miRNA-2 Accession No.
MIMAT0022384
Mature miRNA-2 Name
mmu-miR-344h-3p
Mature miRNA-2 sequence
GGUAUAACCAAAGCCCGACUGU

Quick Inquiry

   Please input "biogene" as verification code.