Tel: 1-631-626-9181 (USA)   44-207-097-1828 (Europe)
  Email:

pEZX-AM02-hsa-mir-24-2

Cat.No.
MIPHS3118
Description
Homo sapiens miR-24-2 stem-loop
Reporter
mCherry
Selection Marker
Puromycin
Size/Form
purified plasmid or bacterial stock
Species
Human
Storage
Typically ships in 3-4 weeks
Vector Type
plasmid
miRNA Information
Precursor Accession No.
MI0000081
Precursor Name
hsa-mir-24-2
Precursors sequence
cucugccucccgugccuacugagcugaaacacagu ugguuuguguacacuggcucaguucagcaggaaca ggg
Mature miRNA-1 Accession No.
MIMAT0004497
Mature miRNA-1 Name
hsa-miR-24-2-5p
Mature miRNA-1 sequence
ugccuacugagcugaaacacag
Mature miRNA-2 Accession No.
MIMAT0000080
Mature miRNA-2 Name
hsa-miR-24-3p
Mature miRNA-2 sequence
uggcucaguucagcaggaacag

Quick Inquiry

   Please input "biogene" as verification code.