Tel: 1-631-626-9181 (USA)   44-207-097-1828 (Europe)
  Email:

pEZX-AM03-hsa-mir-138-1

Cat.No.
MIPHS5043
pEZX-AM03-hsa-mir-138-1
Description
Homo sapiens miR-138-1 stem-loop
Reporter
mCherry
Selection Marker
Hygromycin
Size/Form
purified plasmid or bacterial stock
Species
Human
Storage
Typically ships in 3-4 weeks
Vector Type
plasmid
miRNA Information
Precursor Accession No.
MI0000476
Precursor Name
hsa-mir-138-1
Precursors sequence
cccuggcauggugugguggggcagcugguguugug aaucaggccguugccaaucagagaacggcuacuuc acaacaccagggccacaccacacuacagg
Mature miRNA-1 Accession No.
MIMAT0000430
Mature miRNA-1 Name
hsa-miR-138-5p
Mature miRNA-1 sequence
agcugguguugugaaucaggccg
Mature miRNA-2 Accession No.
MIMAT0004607
Mature miRNA-2 Name
hsa-miR-138-1-3p
Mature miRNA-2 sequence
gcuacuucacaacaccagggcc

Quick Inquiry

   Please input "biogene" as verification code.