Tel: 1-631-626-9181 (USA)   44-207-097-1828 (Europe)

pEZX-AM01-hsa-mir-1302-1

Cat.No.
MIPHS0781
Species
Human
Product Description
Homo sapiens miR-1302-1 stem-loop
Size/form
purified plasmid or bacterial stock
MiRNA information
Precursor Accession No.
MI0006362
Precursor Name
hsa-mir-1302-1
Precursors sequence
cagaaagcccaguuaaauuugaauuucaaguaaac aaugaauaauuguguauguaagaauaucccauaca auauuugggacauacuuaugcuaaaaauua uucc uugcuuaucugaaauucaaauguaacuaggauucc ugua
Mature miRNA-1 Accession No.
MIMAT0005890
Mature miRNA-1 Name
hsa-miR-1302
Mature miRNA-1 sequence
uugggacauacuuaugcuaaa
Mature miRNA-2 Accession No.
HmiR0587-MR03
Mature miRNA-2 sequence
CMV
Storage
Typically ships in 3-4 weeks

Quick Inquiry

Please input "biogene" as verification code.

Contact Us

USA

Europe

CBpromise   

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER