Tel: 1-631-626-9181 (USA)   44-207-097-1828 (Europe)
  Email:

pEZX-AM01-hsa-mir-1302-1

Cat.No.
MIPHS0781
Description
Homo sapiens miR-1302-1 stem-loop
Reporter
mCherry
Selection Marker
Puromycin
Size/Form
purified plasmid or bacterial stock
Species
Human
Storage
Typically ships in 3-4 weeks
Vector Type
plasmid
miRNA Information
Precursor Accession No.
MI0006362
Precursor Name
hsa-mir-1302-1
Precursors sequence
cagaaagcccaguuaaauuugaauuucaaguaaac aaugaauaauuguguauguaagaauaucccauaca auauuugggacauacuuaugcuaaaaauuauucc uugcuuaucugaaauucaaauguaacuaggauucc ugua
Mature miRNA-1 Accession No.
MIMAT0005890
Mature miRNA-1 Name
hsa-miR-1302
Mature miRNA-1 sequence
uugggacauacuuaugcuaaa
Mature miRNA-2 Accession No.
HmiR0587-MR03
Mature miRNA-2 sequence
CMV

Quick Inquiry

   Please input "biogene" as verification code.