Steroid hormones are essential for mammalian survival, playing critical roles in carbohydrate metabolism, stress response, and reproductive function. To investigate mitochondrial cholesterol transport and the molten globule state of key proteins in steroidogenesis, this experimental protocol provides a systematic in vitro and ex vivo workflow, including transfection of non-steroidogenic cells, measurement of steroidogenic activity, and metabolic conversion analysis. By combining recombinant proteins (such as StAR, P450scc, and 3βHSD2) with mitochondrial systems, this approach enables quantitative assessment of cholesterol transport and precursor hormone (pregnenolone/progesterone) production, while also allowing identification of protein molten globule intermediate states in live cells or cell-free systems. This provides a reliable tool for studying protein folding, function, and metabolic regulation.
Figure 1. Key materials used in this protocol include Plasmid Bluescript-KS (VET1448) provided by Creative Biogene. (Bose HS, et al., 2025)
pBluescript II KS(+) is a commonly used cloning vector in molecular biology research. It has various applications, including:
1. Cloning and amplification of DNA sequences: PBluescript II-KS (+) can be used to clone and amplify DNA fragments of interest. It contains the necessary elements, such as an origin of replication and antibiotic resistance genes, which allow for the stable maintenance and amplification of the inserted DNA.
2. Gene expression studies: The vector contains a multiple cloning site (MCS) that enables the insertion of DNA fragments in the correct reading frames for expression studies. Additionally, it provides the necessary control elements, such as promoters and terminators, for gene expression analysis.
3. Construction of recombinant plasmids: PBluescript II-KS (+) can be used as a backbone vector to construct recombinant plasmids for various purposes, such as protein expression, protein purification, or protein-protein interaction studies.
4. DNA sequencing: The vector contains a T7 and T3 promoter flanking the MCS region, allowing for the easy synthesis of RNA probes for DNA sequencing. This enables efficient DNA sequencing of cloned fragments.
5. Mutagenesis studies: PBluescript II-KS (+) can be used for site-directed mutagenesis studies. The vector's MCS region allows for the introduction of specific mutations in the cloned DNA fragment, enabling the study of functional domains or specific amino acid residues.
6. Subcloning and DNA manipulation: The vector has a small size (2961 bp) and its MCS region provides unique restriction enzyme recognition sites, allowing for easy subcloning and manipulation of DNA fragments.
Customer Q&As
What is pBluescript II KS(+)?
A: PBluescript II-KS (+) is the plasmids of Escherichia coli. It is a cloned carrier, which is derived from phage.
What are the applications of PBluescript II-KS (+)?
A: PBluescript II-KS (+) is commonly used in cloning and sequencing, including DNA sequencing, nested deletion, RNA transcription, site-directed mutagenesis, and gene mapping in vitro.
How many unique restriction endonuclease loci does PBluescript II-KS (+) contain?
A: PBluescript II-KS (+) contains 21 unique restriction endonuclease loci.
What is the 5' sequencing primer for pBluescript II KS(+) vector?
A: The 5' sequencing primer for pBluescript II KS(+) vector is T7 (TAATACGACTCACTATAGGG).
Ask a Question
Customer Reviews
Wide scope of application
The pBluescript II KS(+) vector is highly versatile and can accommodate a wide range of DNA fragment sizes, making it suitable for various molecular biology applications.
United Kingdom
01/25/2024
Selection markers
The pBluescript II KS(+) vector contains the ampicillin resistance gene (ampR), which allows for the selection of transformed bacterial cells.
Write a Review