Pages
Products

pBluescript II KS(+)

For research use only. Not intended for any clinical use.
Cat.No.
VET1448
Background
pBluescript II phagemids (plasmids of bacteriophage origin) are cloning vectors designed to simplify commonly used cloning and sequencing procedures, including construction of nested deletions for DNA sequencing, in vitro generation of RNA transcripts, and site-directed mutagenesis and gene mapping. The pBluescript II phagemid has an extensive polylinker with 21 unique restriction enzyme recognition sites. The polylinker is flanked by T7 and T3 RNA polymerase promoters and can be used to synthesize RNA in vitro. The choice of promoter used to initiate transcription determines which strand of the insert cloned into the polylinker will be transcribed.
Host Cell
Escherichia coli
Promoter
T7/T3
Resistance
Ampicillin
Vector Size
2961 bp
Vector Type
Expression Vector

Applications

Publications

Q & A

Customer Reviews

pBluescript II KS(+) is a commonly used cloning vector in molecular biology research. It has various applications, including: 1. Cloning and amplification of DNA sequences: PBluescript II-KS (+) can be used to clone and amplify DNA fragments of interest. It contains the necessary elements, such as an origin of replication and antibiotic resistance genes, which allow for the stable maintenance and amplification of the inserted DNA. 2. Gene expression studies: The vector contains a multiple cloning site (MCS) that enables the insertion of DNA fragments in the correct reading frames for expression studies. Additionally, it provides the necessary control elements, such as promoters and terminators, for gene expression analysis. 3. Construction of recombinant plasmids: PBluescript II-KS (+) can be used as a backbone vector to construct recombinant plasmids for various purposes, such as protein expression, protein purification, or protein-protein interaction studies. 4. DNA sequencing: The vector contains a T7 and T3 promoter flanking the MCS region, allowing for the easy synthesis of RNA probes for DNA sequencing. This enables efficient DNA sequencing of cloned fragments. 5. Mutagenesis studies: PBluescript II-KS (+) can be used for site-directed mutagenesis studies. The vector's MCS region allows for the introduction of specific mutations in the cloned DNA fragment, enabling the study of functional domains or specific amino acid residues. 6. Subcloning and DNA manipulation: The vector has a small size (2961 bp) and its MCS region provides unique restriction enzyme recognition sites, allowing for easy subcloning and manipulation of DNA fragments.
Customer Q&As
What is pBluescript II KS(+)?

A: PBluescript II-KS (+) is the plasmids of Escherichia coli. It is a cloned carrier, which is derived from phage.

What are the applications of PBluescript II-KS (+)?

A: PBluescript II-KS (+) is commonly used in cloning and sequencing, including DNA sequencing, nested deletion, RNA transcription, site-directed mutagenesis, and gene mapping in vitro.

How many unique restriction endonuclease loci does PBluescript II-KS (+) contain?

A: PBluescript II-KS (+) contains 21 unique restriction endonuclease loci.

What is the 5' sequencing primer for pBluescript II KS(+) vector?

A: The 5' sequencing primer for pBluescript II KS(+) vector is T7 (TAATACGACTCACTATAGGG).

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Customer Reviews
Wide scope of application

The pBluescript II KS(+) vector is highly versatile and can accommodate a wide range of DNA fragment sizes, making it suitable for various molecular biology applications.

United Kingdom

01/25/2024

Selection markers

The pBluescript II KS(+) vector contains the ampicillin resistance gene (ampR), which allows for the selection of transformed bacterial cells.

French

06/17/2020

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction

CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER
Quick Inquiry

Inquiry