Pages
Products

pXMJ19

For research use only. Not intended for any clinical use.
Cat.No.
OVT2575
Selection
Chloramphenicol
Source
Corynebacterium glutamicum, Escherichia coli
Species
Bacterial

Background

Case Study

Applications

Publications

Q & A

Customer Reviews

pXMJ19 is a type of plasmid that acts as a Corynebacterium glutamiens / Escherichia coli shuttle plasmid. This biotechnological tool is specifically designed for growth in the Strain DH5α and inculturated in an LB medium with a temperature requirement of 37 degrees Celsius. The pXMJ19 plasmid represents a highly intricate and functionally diverse aspect of microbiology, and it does not possess the ability to determine between high copy and low copy. pXMJ19 has a carrier size measured at 6601 base pairs. In terms of its sequencing primers and sequences, the 5' ones include LacI-R (GGCATACTCTGCGACATCGT) and Tac promoter (GAGCGGATAACAATTTCACACAGG). pXMJ19 has the unique carrier label and shows resistance to chloramphenicol, a type of antibiotic.

In terms of protein production, the host's internal environment affects the activity of expression elements, thereby affecting the expression level of the target protein. Native expression elements from a specific strain always work well in the original host. In this study, in order to improve the endoxylanase (XynA) production level of C. glutamicum CGMCC1.15647 and its natural expression element, methods to reduce host expression barriers and promote expression were evaluated. Researchers identified the CspB2 signal peptide in C. glutamicum CGMCC1.15647 by MALDI-TOF and applied it together with its promoter for the production of endoxylanase (XynA) in this strain. For XynA expression in C. glutamicum CGMCC1.15647, the native cspB2 promoter and cspB2 signal peptide are better than the commonly used cspB1 promoter and cspA signal peptide, and expression in this strain is superior to the expression in C. glutamicum ATCC13032. The highest levels of XynA secretion efficiency at the deep 24-well plate level were achieved by disruption of the cell wall protein CspB2 and the protease ClpS, chromosomal integration of xynA and coexisting plasmid expression, which increased expression 11.43- and 1.35-fold compared to that of chromosomal expression and pXMJ19-xynA-mediated expression in the original strain, respectively.

XynA plays a key role in the degradation of xylan, one of nature's most renewable biomass energy sources. In this study, researchers used the endogenous cspB2 signal peptide and its promoter to produce XynA. The wild-type C. glutamicum CGMCCl.15647 was transformed with the pXMJ19 and pXMJ19-xynA plasmid to obtain Cg47+P19-0 (C. glutamicum CGMCCl.15647 carrying pXMJ19) and Cg47+P19-X (C. glutamicum CGMCCl.15647 carrying pXMJ19-xynA), respectively. After 48 h of culture, the XynA activity in the culture supernatant of Cg47+P19-X reached 1849.03 U/mL, which was higher than the production (1504.27 U/mL) of Cg47+P19-cspB1X (C. glutamicum CGMCCl.15647 carrying pXMJ19-cspB1-cspA-xynA) (Figure 1). This result shows that the endogenous cspB2 promoter, 5'UTR and signal peptide of C. glutamicum CGMCCl.15647 can successfully express and secrete XynA, and the endogenous cspB2 promoter and cspB2 signal peptide is superior to the cspB1 promoter and cspA signal peptide for XynA production in C. glutamicum CGMCCl.15647 under the same culture conditions.

Comparison of the production of XynA using different promoters, signal peptides and hosts.Figure 1. Comparison of the production of XynA using different promoters, signal peptides and hosts. (Zhang W, et al., 2019)

The pXMJ19 vector is widely used in various biological and scientific applications. Here are some of its key applications: Cloning: The pXMJ19 vector is commonly used for cloning applications in molecular biology. It allows scientists to insert specific DNA sequences into its plasmid, thus creating a new combination of genes. Gene Expression: The pXMJ19 vector can be used to control and study gene expression. Scientists can manipulate its promoter region to control when and how a particular gene is expressed. This is essential in studying gene function and regulation, understanding diseases, and developing treatments. Protein Production: The pXMJ19 vector can facilitate large-scale protein production necessary for structural and functional studies of proteins. Scientists can insert the corresponding gene into the pXMJ19 vector, transfer it into suitable host cells, and then induce these cells to express and produce the protein in large amounts.
Customer Q&As
What is the size of the pXMJ19 vector?

A: The size of pXMJ19 vector is 6601 bp?

What are the 5' sequencing primers and sequences?

A: LacI-R: GGCATACTCTGCGACATCGT;
Tac promoter: GAGCGGATAACAATTTCACACAGG

What is Corynebacterium glutamicum?

A: Corynebacterium glutamicum is a traditional food-grade industrial microorganism which has been developed as a novel endotoxin-free recombinant protein expression host in recent years

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Customer Reviews
Stable and High Expression

The pXMJ19 vector can drive stable and high-level gene expression. This is advantageous for obtaining high expression levels of the recombinant protein.

French

12/16/2023

Extensive Applications

Due to its broad-host-range feature, the pXMJ19 vector can be transfected into various types of bacteria. We can use this one vector across different studies, saving time and resources.

Germany

11/13/2021

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction

CBpromise

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER
Quick Inquiry

Inquiry