Creative biogene
SHARE THIS
facebook twitterlinkedingoogle plusStumbleUpon blog


pEZX-AM02-hsa-mir-550a-2

Cat.No.
MIPHS3475
Species
Human
Product Description
Homo sapiens miR-550-2 stem-loop
Size/form
purified plasmid or bacterial stock
MiRNA information
Precursor Accession No.
MI0003601
Precursor Name
hsa-mir-550a-2
Precursors sequence
ugaugcuuugcuggcuggugcagugccugagggag uaagagcccuguuguugucagauagugucuuacuc ccucaggcacaucuccagcgagucucu
Mature miRNA-1 Accession No.
MIMAT0004800
Mature miRNA-1 Name
hsa-miR-550a-5p
Mature miRNA-1 sequence
agugccugagggaguaagagccc
Mature miRNA-2 Accession No.
MIMAT0003257
Mature miRNA-2 Name
hsa-miR-550a-3p
Mature miRNA-2 sequence
ugucuuacucccucaggcacau
Storage
Typically ships in 3-4 weeks
Related Products
Cat#
Product Name
Titer
Product Size
Species
Price
AD00621W
1X10^9 viral particles/ml
1 x 0.2 ml
Human
AD00619W
1X10^9 viral particles/ml
1 x 0.2 ml
Human
AD00622W
1X10^9 viral particles/ml
1 x 0.2 ml
Human
AD00620W
1X10^9 viral particles/ml
1 x 0.2 ml
Human
Cat#
Product Name
Size/Form
Species
Price
MILHS0319
250ul
Human
MILHS0320
250ul
Human
MIPHS1361
purified plasmid or bacterial stock
Human
MIPHS1362
purified plasmid or bacterial stock
Human
MIPHS1365
purified plasmid or bacterial stock
Human

Related Services

Quick Inquiry

Please input "biogene" as verification code.
Contact us to order
USA
45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828
Email: info@creative-biogene.com

Europe
Tel: 44-207-097-1828
Email: info@creative-biogene.com
CBpromise

24x7 CUSTOMER SERVICE

CONTACT US TO ORDER

;

CONTACT CREATIVE BIOGENE

45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828
Email: info@creative-biogene.com

Europe
Tel: 44-207-097-1828

Terms & Conditions | Privacy Policy | Sitemap | FAQ | © 2010-2018 Creative Biogene. All Rights Reserved.