Tel: 1-631-626-9181 (USA)   44-207-097-1828 (Europe)

pEZX-AM02-hsa-mir-550a-2

Cat.No.
MIPHS3475
Species
Human
Product Description
Homo sapiens miR-550-2 stem-loop
Size/form
purified plasmid or bacterial stock
MiRNA information
Precursor Accession No.
MI0003601
Precursor Name
hsa-mir-550a-2
Precursors sequence
ugaugcuuugcuggcuggugcagugccugagggag uaagagcccuguuguugucagauagugucuuacuc ccucaggcacaucuccagcgagucucu
Mature miRNA-1 Accession No.
MIMAT0004800
Mature miRNA-1 Name
hsa-miR-550a-5p
Mature miRNA-1 sequence
agugccugagggaguaagagccc
Mature miRNA-2 Accession No.
MIMAT0003257
Mature miRNA-2 Name
hsa-miR-550a-3p
Mature miRNA-2 sequence
ugucuuacucccucaggcacau
Storage
Typically ships in 3-4 weeks

Quick Inquiry

Please input "biogene" as verification code.

Contact Us

USA

Europe

CBpromise   

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER