Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : CDCV050802
| Cat. No. | CDCV050802 |
| Description | Viral ORF Clone for capsid protein C [Zika virus, strain MR766]. Capsid protein C plays a role in virus budding by binding to the cell membrane and gathering the viral RNA into a nucleocapsid that forms the core of a mature virus particle. |
| Product Type | ORF Clone |
| Gene Symbol | C |
| Species | Zika virus |
| Protein Name | capsid protein C |
| ORF Size | 312 bp |
| Sequence | ATGAAAAACCCCAAAGAAGAAATCCGGAGGATCCGGATTGTCAATATGCTAAAACGCGGAGTAGCCCGTGTAAACCCCTTGGGAGGTTTGAAGAGGTTGCCAGCCGGACTTCTGCTGGGTCATGGACCCATCAGAATGGTTTTGGCGATACTAGCCTTTTTGAGATTTACAGCAATCAAGCCATCACTGGGCCTTATCAACAGATGGGGTTCCGTGGGGAAAAAAGAGGCTATGGAAATAATAAAGAAGTTCAAGAAAGATCTTGCTGCCATGTTGAGAATAATCAATGCTAGGAAAGAGAGGAAGAGACGT |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.