Pages
Products

ZIKV pr ORF Clone

For research use only. Not intended for any clinical use.

Cat. No. :   CDCV050804

Inquire for Price

Product Information

Cat. No. CDCV050804
Description Viral ORF Clone for protein pr [Zika virus, strain MR766].
Product Type ORF Clone
Gene Symbol pr
Species Zika virus
Protein Name protein pr
ORF Size 279 bp
Sequence GCAGAGATCACTAGACGCGGGAGTGCATACTACATGTACTTGGATAGGAGCGATGCCGGGAAGGCCATTTCGTTTGCTACCACATTGGGAGTGAACAAGTGCCACGTACAGATCATGGACCTCGGGCACATGTGTGACGCCACCATGAGTTATGAGTGCCCTATGCTGGATGAGGGAGTGGAACCAGATGATGTCGATTGCTGGTGCAACACGACATCAACTTGGGTTGTGTACGGAACCTGTCATCACAAAAAAGGTGAGGCACGGCGATCTAGAAGA
Quick Inquiry

Q & A

Customer Reviews

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction