Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : CDCV050812
| Cat. No. | CDCV050812 |
| Description | Viral ORF Clone for protein 2K [Zika virus, strain MR766]. Peptide 2k plays a role as a signal peptide for NS4B and is required for the interferon antagonism activity of the latter. |
| Product Type | ORF Clone |
| Gene Symbol | 2K |
| Species | Zika virus |
| Protein Name | protein 2K |
| ORF Size | 69 bp |
| Sequence | TCTCCCCAAGATAACCAGATGGCAATTATCATCATGGTGGCAGTGGGCCTTCTAGGTTTGATAACTGCA |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.