Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MIPRS4719
| Cat. No. | MIPRS4719 |
| Species | Rat |
| Reporter | Luc2 |
| Size | 20μg |
|
Precursor Accession No. MI0000841 Precursor Name rno-mir-10a Precursors sequence GACCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCC GAAUUUGUGUAAGGAAUUUUGUGGUCACAAAUUCG UAUCUAGGGGAAUAUGUAGUUGACAUAAACACUCC GCUCA Precursors Length 110 bp Gene Description Rattus norvegicus miR-10a stem-loop Gene Species Rat Mature miRNA-1 Accession No. MIMAT0000782 Mature miRNA-1 Name rno-miR-10a-5p Mature miRNA-1 sequence UACCCUGUAGAUCCGAAUUUGUG Mature miRNA-2 Accession No. MIMAT0004709 Mature miRNA-2 Name rno-miR-10a-3p Mature miRNA-2 sequence CAAAUUCGUAUCUAGGGGAAUA |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.