Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MIPHS15987
| Cat. No. | MIPHS15987 |
| Species | Human |
| Reporter | mCherry |
| Size | 20 ug |
|
Precursor Accession No. MI0000816 Precursor Name hsa-mir-335 Precursors sequence UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAA UGUUUGUCAUAAACCGUUUUUCAUUAUUGCUCCUG ACCUCCUCUCAUUUGCUAUAUUCA Precursors Length 94 bp Gene Description Homo sapiens miR-335 stem-loop Gene Species Human Mature miRNA-1 Accession No. MIMAT0000765 Mature miRNA-1 Name hsa-miR-335-5p Mature miRNA-1 sequence UCAAGAGCAAUAACGAAAAAUGU Mature miRNA-2 Accession No. MIMAT0004703 Mature miRNA-2 Name hsa-miR-335-3p Mature miRNA-2 sequence UUUUUCAUUAUUGCUCCUGACC |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.