Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Premade Virus Particles
Ready-to-Use | High Titer | Versatile Applications
Premade AAV, adenovirus, lentivirus particles, safe, stable, in stock.
Virus-Like Particles (VLPs)
Stable | Scalable | Customizable
Advanced VLPs for vaccine development (Chikungunya, Dengue, SARS-CoV-2), gene therapy (AAV1 & AAV9), and drug screening (SSTR2, CCR5).
Oligonucleotide Products
Precise | High Yield | Tailored Solutions
Accelerate your research with cost-effective LncRNA qPCR Array Technology.
RNA Interference Products
Targeted | Potent | High Specificity
Human Druggable Genome siRNA Library enables efficient drug target screening.
Recombinant Drug Target Proteins
Authentic | Versatile | Accelerated
Providing functional, high-purity recombinant proteins—including membrane proteins and nanodiscs—to overcome bottlenecks in drug screening and target validation.
Clones
Validated | Reliable | Comprehensive Collection
Ready-to-use clones for streamlined research and development.
Kits
Complete | Convenient | High Sensitivity
Chromogenic LAL Endotoxin Assay Kit ensures precise, FDA-compliant endotoxin quantification for biosafety testing.
Enzymes
Purified | Stable | Efficient
Powerful Tn5 Transposase for DNA insertion and random library construction.
Aptamers
Highly Specific | Robust | Versatile
Aptamers for key proteins like ACVR1A, Akt, EGFR, and VEGFR.
Adjuvants
Enhancing | Synergistic | Effective
Enhance immune responses with high-purity, potent CpG ODNs.
Laboratory Equipment
Innovative | Reliable | High-Precision
Effortlessly streamline DNA extraction with CB™ Magnetic-Nanoparticle Systems.
Stable Cell Line Generation
Reliable | Scalable | Customizable
Fast proposals, regular updates, and detailed reports; strict quality control, and contamination-free cells; knockout results in 4-6 weeks.
Target-based Drug Discovery Service
Innovative | Comprehensive | Efficient
Target identification, validation, and screening for drug discovery and therapeutic development.
Custom Viral Service
Versatile | High-Yield | Safe
Unbeatable pricing, fully customizable viral packaging services (covering 30,000+ human genes, 200+ mammals, 50+ protein tags).
Custom Antibody Service
Precise | Flexible | Efficient
End-to-end antibody development support, from target to validation, enabling clients to rapidly obtain application-ready antibodies.
Antibody-Drug Conjugation Service
Integrated | Controlled | Translational
Comprehensive solutions covering design, development, and validation to ensure conjugated drugs with consistent quality and clinical potential.
Protein Degrader Service
Efficient | High-Precision | Advanced Therapeutics
Harness the power of protein degraders for precise protein degradation, expanding druggable targets and enhancing therapeutic effectiveness for cutting-edge drug discovery.
Nucleotides Service
Accurate | Flexible | High-Quality
Custom synthesis of oligonucleotides, primers, and probes for gene editing, PCR, and RNA studies.
Custom RNA Service
Custom RNA ServicePrecise | Flexible | GMP-ReadyCustom
RNA design, synthesis, and manufacturing—covering mRNA, saRNA, circRNA, and RNAi. Fast turnaround, rigorous QC, and seamless transition from research to GMP production.
Custom Libraries Construction Service
Comprehensive | High-throughput | Accurate
Custom cDNA, genomic, and mutagenesis libraries for drug discovery, screening, and functional genomics.
Gene Editing Services
Precise | Efficient | Targeted
Gene editing solutions for gene editing, knockouts, knock-ins, and customized genetic modifications. Integrated multi-platform solutions for one-stop CRISPR sgRNA library synthesis and gene screening services
Microbe Genome Editing Service
Precise | Scalable | Customizable
Enhance microbial productivity with advanced genome editing using Rec-mediated recombination and CRISPR/Cas9 technologies.
Biosafety Testing Service
Reliable | Comprehensive | Regulated
Complete biosafety testing solutions for gene therapy, viral vectors, and biologics development.
Plant Genetic Modification Service
Advanced | Sustainable | Tailored
Genetic modification for crop improvement, biotechnology, and plant-based research solutions.
Plant-based Protein Production Service
Efficient | Scalable | Customizable
Plant-based protein expression systems for biopharmaceuticals, enzyme production, and research.
Aptamer Discovery & SELEX Solutions
Innovative | Fast | Cost-Effective
Revolutionizing drug delivery and diagnostic development with next-generation high-throughput aptamer selection and synthesis technologies.
Membrane Proteome Chip Antibody Off-Target Screening Service
Membrane Proteome Chip Antibody Off‑Target Screening
Native‑conformation | Quantitative | Cross‑reactivity free
CGT Biosafety Testing
Comprehensive | Accurate | Regulatory-compliant
Internationally certified evaluation system for biologics, gene therapies, nucleic acid drugs, and vaccines.
Pandemic Detection Solutions
Rapid | Precise | Scalable
Balancing accuracy, accessibility, affordability, and rapid detection to safeguard public health and strengthen global response to infectious diseases.
cGMP Cell Line Development
Reliable | Scalable | Industry-leading
Stable expression over 15 generations with rapid cell line development in just 3 months.
Supports adherent and suspension cell lines, offering MCB, WCB, and PCB establishment.
GMP mRNA Production
Efficient | Scalable | Precise
Scalable mRNA production from milligrams to grams, with personalized process design for sequence optimization, cap selection, and nucleotide modifications, all in one service.
GMP Plasmid Production
High Quality | Scalable | Regulatory-compliant
Our plasmid production services span Non-GMP, GMP-Like, and GMP-Grade levels, with specialized options for linearized plasmids.
GMP Viral Vector Manufacturing
Scalable | High Yield | Quality-driven
Advanced platforms for AAV, adenovirus, lentivirus, and retrovirus production, with strict adherence to GMP guidelines and robust quality control.
AI-Driven Gene Editing and Therapy
Innovative | Precision | Transformative
AI-powered one-click design for customized CRISPR gene editing strategy development.
AI-Antibody Engineering Fusion
Next-Generation | Targeted | Efficient
AI and ML algorithms accelerate antibody screening and predict new structures, unlocking unprecedented possibilities in antibody engineering.
AI-Driven Enzyme Engineering
Smart | Efficient | Tailored
High-throughput enzyme activity testing with proprietary datasets and deep learning models for standardized and precise enzyme engineering design.
AI-Enhanced Small Molecule Screening
Predictive | Efficient | Insightful
Leverage AI to uncover hidden high-potential small molecules, prioritize leads intelligently, and reduce costly trial-and-error in early drug discovery.
AI-Driven Protein Degrader Drug Development
Innovative | Targeted | Accelerated
Use AI-guided design to optimize protein degraders, addressing design complexity and enhancing efficacy while shortening development timelines.
Cat. No. : MIPHS14298
| Cat. No. | MIPHS14298 |
| Species | Human |
| Reporter | ZsGreen1 |
| Size | 20 ug |
|
Precursor Accession No. MI0014173 Precursor Name hsa-mir-3147 Precursors sequence GUCCGGGUUGGGCAGUGAGGAGGGUGUGACGCCGC GAAGUGCACCUCGCCCUUGUCCAACUCGGAC Precursors Length 66 bp Gene Description Homo sapiens miR-3147 stem-loop Gene Species Human Mature miRNA-1 Accession No. MIMAT0015019 Mature miRNA-1 Name hsa-miR-3147 Mature miRNA-1 sequence GGUUGGGCAGUGAGGAGGGUGUGA |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.
| Cat.No. | Product Name | Price |
|---|---|---|
| MIPH2051 | MIR192-pCMV-MIR | Inquiry |
| MIPH2079 | MIR211-pCMV-MIR | Inquiry |
| MIPH2025 | MIR26B-pCMV-MIR | Inquiry |
| MIPH2059 | MIR30d-pCMV-MIR | Inquiry |
| MIPH2048 | MIR106a-pCMV-MIR | Inquiry |
| MIPH2067 | MIR34a-pCMV-MIR | Inquiry |
| MIPH2068 | MIR181A2-pCMV-MIR | Inquiry |
| MIPH2142 | MIR193a-pCMV-MIR | Inquiry |
| MIPH2014 | MIR19a-pCMV-MIR | Inquiry |
| MIPH2133 | MIR138-1-pCMV-MIR | Inquiry |
Copyright © 2026 Creative Biogene. All rights reserved.