Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MIPHS14248
| Cat. No. | MIPHS14248 |
| Species | Human |
| Reporter | ZsGreen1 |
| Size | 20 ug |
|
Precursor Accession No. MI0014228 Precursor Name hsa-mir-3065 Precursors sequence CUGCCCUCUUCAACAAAAUCACUGAUGCUGGAGUC GCCUGAGUCAUCACUCAGCACCAGGAUAUUGUUGG AGAGGACAG Precursors Length 79 bp Gene Description Homo sapiens miR-3065 stem-loop Gene Species Human Mature miRNA-1 Accession No. MIMAT0015066 Mature miRNA-1 Name hsa-miR-3065-5p Mature miRNA-1 sequence UCAACAAAAUCACUGAUGCUGGA Mature miRNA-2 Accession No. MIMAT0015378 Mature miRNA-2 Name hsa-miR-3065-3p Mature miRNA-2 sequence UCAGCACCAGGAUAUUGUUGGAG |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.