Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : VET1312
| Cat. No. | VET1312 |
| Host Cell | Mammalian cells, Escherichia coli |
| Promoter | CMV |
| Resistance | Ampicillin |
| Selection | Neomycin |
| Vector Type | Expression Vector |
| Vector Size | 7711 bp |
A: pcDNA3.2/V5-DEST Is the Gateway system carrier, which cannot be used alone.
A: It needs to be used together with the donor carrier and the entry carrier.
A: On the empty vector, there is a ccdB expression box after the CMV promoter, so this empty vector can only be replicated and amplified in a dedicated E. coli such as DB3.1. When using this vector, please pay attention to the corresponding DB3.1 receptor.
A: There are universal primers to detect positive clones that can be used to:T7 Fwd: 5'[TAATACGACTCACTATAGGG]3'
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
I used this vector to get a high proportion of positive clones and a very pure background.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.