Pages
Products

pcDNA3.2/V5-DEST

For research use only. Not intended for any clinical use.

Cat. No. :   VET1312

Inquire for Price

Product Information

Cat. No. VET1312
Host Cell Mammalian cells, Escherichia coli
Promoter CMV
Resistance Ampicillin
Selection Neomycin
Vector Type Expression Vector
Vector Size 7711 bp
Quick Inquiry

Q & A

Customer Reviews

Customer Q&As
What is the system of this vector, and whether it can be used alone?

A: pcDNA3.2/V5-DEST Is the Gateway system carrier, which cannot be used alone.

How will the vector be used?

A: It needs to be used together with the donor carrier and the entry carrier.

Can this empty vector be used in any E. coli species?

A: On the empty vector, there is a ccdB expression box after the CMV promoter, so this empty vector can only be replicated and amplified in a dedicated E. coli such as DB3.1. When using this vector, please pay attention to the corresponding DB3.1 receptor.

Is there a universal primer for detecting the recombinant gene on this vector?

A: There are universal primers to detect positive clones that can be used to:T7 Fwd: 5'[TAATACGACTCACTATAGGG]3'

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Customer Reviews
A Quality Product

I used this vector to get a high proportion of positive clones and a very pure background.

United States

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction