Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : VET1329
| Cat. No. | VET1329 |
| Host Cell | Escherichia coli |
| Promoter | T5 |
| Resistance | Kanamycin |
| Vector Type | Expression Vector |
| Vector Size | 3.6 kb |
A: The pBAV1K-T5-gfp vector has resistance to kanamycin at a concentration of 50 μg/mL.
A: Any strain that has the LacI repressor can be used for growth. However, it is important to note that high levels of GFP expressed from the vector can kill E. coli when in the stationary phase.
A: The 5' sequencing primer is GACGAACTCCAATTCACTGTTCCTTGC, and the 3' sequencing primer is GGAGAGCGTTCACCGACAAACAACAG.
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
The pBAV1K-T5-gfp vector carries the gene encoding green fluorescent protein (GFP), allowing for easy visualization and monitoring of protein expression in real-time.
The pBAV1K-T5-gfp vector contains multiple restriction enzyme recognition sites, enabling flexible cloning of target genes. This feature facilitates the seamless insertion of desired genes into the vector backbone, promoting ease of experimental design and customization.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.