Pages
Products

pBAV1K-T5-gfp

For research use only. Not intended for any clinical use.

Cat. No. :   VET1329

Inquire for Price

Product Information

Cat. No. VET1329
Host Cell Escherichia coli
Promoter T5
Resistance Kanamycin
Vector Type Expression Vector
Vector Size 3.6 kb
Quick Inquiry

Q & A

Customer Reviews

Customer Q&As
What bacterial resistance(s) does the pBAV1K-T5-gfp vector have?

A: The pBAV1K-T5-gfp vector has resistance to kanamycin at a concentration of 50 μg/mL.

What precautions should be taken when growing the pBAV1K-T5-gfp vector?

A: Any strain that has the LacI repressor can be used for growth. However, it is important to note that high levels of GFP expressed from the vector can kill E. coli when in the stationary phase.

What are the 5' and 3' sequencing primers for the pBAV1K-T5-gfp vector?

A: The 5' sequencing primer is GACGAACTCCAATTCACTGTTCCTTGC, and the 3' sequencing primer is GGAGAGCGTTCACCGACAAACAACAG.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Customer Reviews
Monitoring of protein expression

The pBAV1K-T5-gfp vector carries the gene encoding green fluorescent protein (GFP), allowing for easy visualization and monitoring of protein expression in real-time.

Canada

Promoting ease of experimental design

The pBAV1K-T5-gfp vector contains multiple restriction enzyme recognition sites, enabling flexible cloning of target genes. This feature facilitates the seamless insertion of desired genes into the vector backbone, promoting ease of experimental design and customization.

United States

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction