Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Premade Virus Particles
Ready-to-Use | High Titer | Versatile Applications
Premade AAV, adenovirus, lentivirus particles, safe, stable, in stock.
Virus-Like Particles (VLPs)
Stable | Scalable | Customizable
Advanced VLPs for vaccine development (Chikungunya, Dengue, SARS-CoV-2), gene therapy (AAV1 & AAV9), and drug screening (SSTR2, CCR5).
Oligonucleotide Products
Precise | High Yield | Tailored Solutions
Accelerate your research with cost-effective LncRNA qPCR Array Technology.
RNA Interference Products
Targeted | Potent | High Specificity
Human Druggable Genome siRNA Library enables efficient drug target screening.
Recombinant Drug Target Proteins
Authentic | Versatile | Accelerated
Providing functional, high-purity recombinant proteins—including membrane proteins and nanodiscs—to overcome bottlenecks in drug screening and target validation.
Clones
Validated | Reliable | Comprehensive Collection
Ready-to-use clones for streamlined research and development.
Kits
Complete | Convenient | High Sensitivity
Chromogenic LAL Endotoxin Assay Kit ensures precise, FDA-compliant endotoxin quantification for biosafety testing.
Enzymes
Purified | Stable | Efficient
Powerful Tn5 Transposase for DNA insertion and random library construction.
Aptamers
Highly Specific | Robust | Versatile
Aptamers for key proteins like ACVR1A, Akt, EGFR, and VEGFR.
Adjuvants
Enhancing | Synergistic | Effective
Enhance immune responses with high-purity, potent CpG ODNs.
Laboratory Equipment
Innovative | Reliable | High-Precision
Effortlessly streamline DNA extraction with CB™ Magnetic-Nanoparticle Systems.
Stable Cell Line Generation
Reliable | Scalable | Customizable
Fast proposals, regular updates, and detailed reports; strict quality control, and contamination-free cells; knockout results in 4-6 weeks.
Target-based Drug Discovery Service
Innovative | Comprehensive | Efficient
Target identification, validation, and screening for drug discovery and therapeutic development.
Custom Viral Service
Versatile | High-Yield | Safe
Unbeatable pricing, fully customizable viral packaging services (covering 30,000+ human genes, 200+ mammals, 50+ protein tags).
Custom Antibody Service
Precise | Flexible | Efficient
End-to-end antibody development support, from target to validation, enabling clients to rapidly obtain application-ready antibodies.
Antibody-Drug Conjugation Service
Integrated | Controlled | Translational
Comprehensive solutions covering design, development, and validation to ensure conjugated drugs with consistent quality and clinical potential.
Protein Degrader Service
Efficient | High-Precision | Advanced Therapeutics
Harness the power of protein degraders for precise protein degradation, expanding druggable targets and enhancing therapeutic effectiveness for cutting-edge drug discovery.
Nucleotides Service
Accurate | Flexible | High-Quality
Custom synthesis of oligonucleotides, primers, and probes for gene editing, PCR, and RNA studies.
Custom RNA Service
Custom RNA ServicePrecise | Flexible | GMP-ReadyCustom
RNA design, synthesis, and manufacturing—covering mRNA, saRNA, circRNA, and RNAi. Fast turnaround, rigorous QC, and seamless transition from research to GMP production.
Custom Libraries Construction Service
Comprehensive | High-throughput | Accurate
Custom cDNA, genomic, and mutagenesis libraries for drug discovery, screening, and functional genomics.
Gene Editing Services
Precise | Efficient | Targeted
Gene editing solutions for gene editing, knockouts, knock-ins, and customized genetic modifications. Integrated multi-platform solutions for one-stop CRISPR sgRNA library synthesis and gene screening services
Microbe Genome Editing Service
Precise | Scalable | Customizable
Enhance microbial productivity with advanced genome editing using Rec-mediated recombination and CRISPR/Cas9 technologies.
Biosafety Testing Service
Reliable | Comprehensive | Regulated
Complete biosafety testing solutions for gene therapy, viral vectors, and biologics development.
Plant Genetic Modification Service
Advanced | Sustainable | Tailored
Genetic modification for crop improvement, biotechnology, and plant-based research solutions.
Plant-based Protein Production Service
Efficient | Scalable | Customizable
Plant-based protein expression systems for biopharmaceuticals, enzyme production, and research.
Aptamers Service
Innovative | Fast | Cost-Effective
Revolutionizing drug delivery and diagnostic development with next-generation high-throughput aptamer selection and synthesis technologies.
CGT Biosafety Testing
Comprehensive | Accurate | Regulatory-compliant
Internationally certified evaluation system for biologics, gene therapies, nucleic acid drugs, and vaccines.
Pandemic Detection Solutions
Rapid | Precise | Scalable
Balancing accuracy, accessibility, affordability, and rapid detection to safeguard public health and strengthen global response to infectious diseases.
cGMP Cell Line Development
Reliable | Scalable | Industry-leading
Stable expression over 15 generations with rapid cell line development in just 3 months.
Supports adherent and suspension cell lines, offering MCB, WCB, and PCB establishment.
GMP mRNA Production
Efficient | Scalable | Precise
Scalable mRNA production from milligrams to grams, with personalized process design for sequence optimization, cap selection, and nucleotide modifications, all in one service.
GMP Plasmid Production
High Quality | Scalable | Regulatory-compliant
Our plasmid production services span Non-GMP, GMP-Like, and GMP-Grade levels, with specialized options for linearized plasmids.
GMP Viral Vector Manufacturing
Scalable | High Yield | Quality-driven
Advanced platforms for AAV, adenovirus, lentivirus, and retrovirus production, with strict adherence to GMP guidelines and robust quality control.
AI-Driven Gene Editing and Therapy
Innovative | Precision | Transformative
AI-powered one-click design for customized CRISPR gene editing strategy development.
AI-Antibody Engineering Fusion
Next-Generation | Targeted | Efficient
AI and ML algorithms accelerate antibody screening and predict new structures, unlocking unprecedented possibilities in antibody engineering.
AI-Driven Enzyme Engineering
Smart | Efficient | Tailored
High-throughput enzyme activity testing with proprietary datasets and deep learning models for standardized and precise enzyme engineering design.
AI-Enhanced Small Molecule Screening
Predictive | Efficient | Insightful
Leverage AI to uncover hidden high-potential small molecules, prioritize leads intelligently, and reduce costly trial-and-error in early drug discovery.
AI-Driven Protein Degrader Drug Development
Innovative | Targeted | Accelerated
Use AI-guided design to optimize protein degraders, addressing design complexity and enhancing efficacy while shortening development timelines.
A: The pBAV1K-T5-gfp vector has resistance to kanamycin at a concentration of 50 μg/mL.
A: Any strain that has the LacI repressor can be used for growth. However, it is important to note that high levels of GFP expressed from the vector can kill E. coli when in the stationary phase.
A: The 5' sequencing primer is GACGAACTCCAATTCACTGTTCCTTGC, and the 3' sequencing primer is GGAGAGCGTTCACCGACAAACAACAG.
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
The pBAV1K-T5-gfp vector carries the gene encoding green fluorescent protein (GFP), allowing for easy visualization and monitoring of protein expression in real-time.
Canada
10/01/2022
The pBAV1K-T5-gfp vector contains multiple restriction enzyme recognition sites, enabling flexible cloning of target genes. This feature facilitates the seamless insertion of desired genes into the vector backbone, promoting ease of experimental design and customization.
United States
07/16/2021
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.
| Cat.No. | Product Name | Price |
|---|---|---|
| VET1239 | pVL1393 | Inquiry |
| VET1616 | pGWB18 | Inquiry |
| VET1394 | pFLAG-CMV-3 | Inquiry |
| VET1561 | pCSN44 | Inquiry |
| VET1665 | pAcGFP1-C3 | Inquiry |
| VET1506 | pET-32c(+) | Inquiry |
| VET1081 | pPink HC vector | Inquiry |
| VET1364 | pSV2-dhfr | Inquiry |
| VET1765 | pCold-GST | Inquiry |
| VET1323 | pET-28a-EGFP-C | Inquiry |
Our promise to you:
Guaranteed product quality, expert customer support.
24x7 CUSTOMER SERVICE
CONTACT US TO ORDER
Inquiry
Copyright © Creative Biogene. All rights reserved.