Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILMS3118
| Cat. No. | MILMS3118 |
| Species | Mouse |
| Resistance | kanr |
| Size | 500ng |
| Vector Type | lentivirus |
|
|
Precursor Accession No. MI0004707 Precursor Name mmu-mir-718 Precursors sequence ACGCCCCCGUGUGGCGGAAGGCCGCGGAGGGCAAG AUGGCGGCGGGUCGAGCGCCGCCUCUUCCGCCCGG CCGGGUGUCGCACGAGGC Precursors Length 88 bp Gene Description Mus musculus miR-718 stem-loop Gene Species Mouse Mature miRNA-1 AccessionNo. MIMAT0003514 Mature miRNA-1 Name mmu-miR-718 Mature miRNA-1 sequence CUUCCGCCCGGCCGGGUGUCG |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.