Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS3790
| Cat. No. | MILHS3790 |
| Species | Human |
| Resistance | kanr |
| Titer | 107 pfu/ml |
| Size | 2 x 50ul |
| Vector Type | lentivirus |
|
|
Precursor Accession No. MI0006372 Precursor Name hsa-mir-1305 Precursors sequence AAGAUCCUGCUGUUUCUACCAUUAGUUUUGAAUGU UUAUUGUAAAGAUACUUUUCAACUCUAAUGGGAGA GACAGCAGGAUUCUCC Precursors Length 86 bp Gene Description Homo sapiens miR-1305 stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0005893 Mature miRNA-1 Name hsa-miR-1305 Mature miRNA-1 sequence UUUUCAACUCUAAUGGGAGAGA Chromosome Location Chromosome 4:183327440:183327525 (+ Strand) |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.