Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS3584
| Cat. No. | MILHS3584 |
| Species | Human |
| Resistance | kanr |
| Size | 500ng |
| Vector Type | lentivirus |
|
|
Precursor Accession No. MI0003938 Precursor Name hsa-mir-1298 Precursors sequence AGACGAGGAGUUAAGAGUUCAUUCGGCUGUCCAGA UGUAUCCAAGUACCCUGUGUUAUUUGGCAAUAAAU ACAUCUGGGCAACUGACUGAACUUUUCACUUUUCA UGACUCA Precursors Length 112 bp Gene Description Homo sapiens miR-1298 stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0005800 Mature miRNA-1 Name hsa-miR-1298 Mature miRNA-1 sequence UUCAUUCGGCUGUCCAGAUGUA Chromosome Location Chromosome X:113855906:113856017 (+ Strand) |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.