Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS6340
| Cat. No. | MILHS6340 |
| Species | Human |
| Reporter | GFP |
| Resistance | kanr |
| Size | 500ng |
| Vector Type | lentivirus |
|
|
Precursor Accession No. MI0015893 Precursor Name hsa-mir-4284 Precursors sequence GUUCUGUGAGGGGCUCACAUCACCCCAUCAAAGUG GGGACUCAUGGGGAGAGGGGGUAGUUAGGAGCUUU GAUAGAGGCGG Precursors Length 81 bp Gene Description Homo sapiens miR-4284 stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0016915 Mature miRNA-1 Name hsa-miR-4284 Mature miRNA-1 sequence GGGCUCACAUCACCCCAU |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.