Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS4975
| Cat. No. | MILHS4975 |
| Species | Human |
| Reporter | GFP |
| Resistance | kanr |
| Size | 500ng |
| Vector Type | lentivirus |
|
|
Precursor Accession No. MI0000783 Precursor Name hsa-mir-375 Precursors sequence CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGA GCGUUUUGUUCGUUCGGCUCGCGUGAGGC Precursors Length 64 bp Gene Description Homo sapiens miR-375 stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0000728 Mature miRNA-1 Name hsa-miR-375 Mature miRNA-1 sequence UUUGUUCGUUCGGCUCGCGUGA Chromosome Location Chromosome 2:219574611:219574674 (- Strand) |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.