Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS6465
| Cat. No. | MILHS6465 |
| Species | Human |
| Reporter | GFP |
| Resistance | kanr |
| Titer | 107 pfu/ml |
| Size | 2 x 50ul |
| Vector Type | lentivirus |
|
|
Precursor Accession No. MI0016065 Precursor Name hsa-mir-3664 Precursors sequence CUGUAAACUUGAAGGUAGGGAACUCUGUCUUCACU CAUGAGUACCUUCCAACACGAGCUCUCAGGAGUAA AGACAGAGUUCCCUACCUUCAAUGUGGAU Precursors Length 99 bp Gene Description Homo sapiens miR-3664 stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0018086 Mature miRNA-1 Name hsa-miR-3664-5p Mature miRNA-1 sequence AACUCUGUCUUCACUCAUGAGU Mature miRNA-2 Accession No. MIMAT0019220 Mature miRNA-2 Name hsa-miR-3664-3p Mature miRNA-2 sequence UCUCAGGAGUAAAGACAGAGUU |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.