Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS5392
| Cat. No. | MILHS5392 |
| Species | Human |
| Reporter | GFP |
| Resistance | kanr |
| Size | 500ng |
| Vector Type | lentivirus |
|
|
Precursor Accession No. MI0003646 Precursor Name hsa-mir-33b Precursors sequence GCGGGCGGCCCCGCGGUGCAUUGCUGUUGCAUUGC ACGUGUGUGAGGCGGGUGCAGUGCCUCGGCAGUGC AGCCCGGAGCCGGCCCCUGGCACCAC Precursors Length 96 bp Gene Description Homo sapiens miR-33b stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0003301 Mature miRNA-1 Name hsa-miR-33b-5p Mature miRNA-1 sequence GUGCAUUGCUGUUGCAUUGC Mature miRNA-2 Accession No. MIMAT0004811 Mature miRNA-2 Name hsa-miR-33b-3p Mature miRNA-2 sequence CAGUGCCUCGGCAGUGCAGCCC Chromosome Location Chromosome 17:17657875:17657970 (- Strand) |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.