Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MIPHS13379
| Cat. No. | MIPHS13379 |
| Description | Homo sapiens mir-4461 stem-loop |
| Species | Human |
| Reporter | eGFP |
| Selection Marker | Puromycin |
| Size | purified plasmid or bacterial stock |
| Vector Type | plasmid |
| Storage | Typically ships in 3-4 business days |
|
Precursor Accession No. MI0016807 Precursor Name hsa-mir-4461 Precursors sequence GAGUAGGCUUAGGUUAUGUACGUAGUCUAGGCCAU ACGUGUUGGAGAUUGAGACUAGUAGGGCUAGGCCU ACUG Mature miRNA-1 Accession No. MIMAT0018983 Mature miRNA-1 Name hsa-miR-4461 Mature miRNA-1 sequence GAUUGAGACUAGUAGGGCUAGGC Mature miRNA-2 Accession No. HmiR1130-MR03 Mature miRNA-2 sequence CMV |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.