Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MIPHS1463
| Cat. No. | MIPHS1463 |
| Description | Homo sapiens miR-636 stem-loop |
| Species | Human |
| Reporter | mCherry |
| Selection Marker | Puromycin |
| Size | purified plasmid or bacterial stock |
| Vector Type | plasmid |
| Storage | Typically ships in 3-4 weeks |
|
Precursor Accession No. MI0003651 Precursor Name hsa-mir-636 Precursors sequence uggcggccugggcgggagcgcgcgggcggggccgg ccccgcugccuggaauuaaccccgcugugcuugcu cgucccgcccgcagcccuaggcggcgucg Mature miRNA-1 Accession No. MIMAT0003306 Mature miRNA-1 Name hsa-miR-636 Mature miRNA-1 sequence ugugcuugcucgucccgcccgca Mature miRNA-2 Accession No. HmiR0288-MR03 Mature miRNA-2 sequence CMV |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.