Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MIPH3163
| Cat. No. | MIPH3163 |
| Description | Each pEP Expression Vector contains a puromycin selection marker. Vectors are supplied as 100 μL of frozen bacterial glycerol stock. |
| Species | human |
| Selection Marker | Puromycin resistance marker |
| Size | 100 μL of bacterial glycerol stock |
| Vector Type | plasmid |
| Storage | -80 oC |
|
Precursor Accession No. MI0003588 Precursor Name hsa-mir-581 Precursors sequence GUUAUGUGAAGGUAUUCUUGUGUUCUCUAGAUCAG UGCUUUUAGAAAAUUUGUGUGAUCUAAAGAACACA AAGAAUACCUACACAGAACCACCUGC Precursors Length 96 bp Gene Description Homo sapiens miR-581 stem-loop Gene Species human Mature miRNA-1 Accession No. MIMAT0003246 Mature miRNA-1 Name hsa-miR-581 Mature miRNA-1 sequence UCUUGUGUUCUCUAGAUCAGU |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.