Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILMS0280
| Cat. No. | MILMS0280 |
| Species | Mouse |
| Reporter | GFP |
| Resistance | Ampr |
| Titer | 106 pfu/ml |
| Size | 250 ul |
| Vector Type | Adenovirus |
|
|
Precursor Accession No. MI0004660 Precursor Name mmu-mir-692-1 Precursors sequence AGGGUGGCAGGGCCACAACCAGCGCAGACUGGCGC GCCCCAGGGAUCUCUGGGUGAGUAUCUCUUUGAGC GCCUCACUCUCAAGCACAACUAGGAGGCCUCUGCC UUCC Precursors Length 109 bp Gene Description Mus musculus miR-692-1 stem-loop Gene Species Mouse Mature miRNA-1 AccessionNo. MIMAT0003471 Mature miRNA-1 Name mmu-miR-692 Mature miRNA-1 sequence AUCUCUUUGAGCGCCUCACUC |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.