Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILMS0460
| Cat. No. | MILMS0460 |
| Species | Mouse |
| Reporter | GFP |
| Resistance | Ampr |
| Titer | 106 pfu/ml |
| Size | 250 ul |
| Vector Type | Adenovirus |
|
|
Precursor Accession No. MI0009964 Precursor Name mmu-mir-1967 Precursors sequence CCUGAAUUCUGUUUCUUUCUCUCUUUGCUCCUUUU GUCUGACAUUCAUGAGGAUCCUGGGGAGAAGAUGC AGAAUUCCCUGG Precursors Length 82 bp Gene Description Mus musculus miR-1967 stem-loop Gene Species Mouse Mature miRNA-1 AccessionNo. MIMAT0009440 Mature miRNA-1 Name mmu-miR-1967 Mature miRNA-1 sequence UGAGGAUCCUGGGGAGAAGAUGC |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.