Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS0817
| Cat. No. | MILHS0817 |
| Species | Human |
| Reporter | GFP |
| Resistance | Ampr |
| Titer | 106 pfu/ml |
| Size | 250 ul |
| Vector Type | Adenovirus |
|
|
Precursor Accession No. MI0015873 Precursor Name hsa-mir-2355 Precursors sequence CAGACGUGUCAUCCCCAGAUACAAUGGACAAUAUG CUAUUAUAAUCGUAUGGCAUUGUCCUUGCUGUUUG GAGAUAAUACUGCUGAC Precursors Length 87 bp Gene Description Homo sapiens miR-2355 stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0016895 Mature miRNA-1 Name hsa-miR-2355-5p Mature miRNA-1 sequence AUCCCCAGAUACAAUGGACAA Mature miRNA-2 Accession No. MIMAT0017950 Mature miRNA-2 Name hsa-miR-2355-3p Mature miRNA-2 sequence AUUGUCCUUGCUGUUUGGAGAU |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.