Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS0527
| Cat. No. | MILHS0527 |
| Species | Human |
| Reporter | GFP |
| Resistance | Ampr |
| Titer | 106 pfu/ml |
| Size | 250 ul |
| Vector Type | Adenovirus |
|
|
Precursor Accession No. MI0006368 Precursor Name hsa-mir-1302-7 Precursors sequence ACAACAUGUUUUUAGGACAUGUAUGUCUGGUGCAA UAAUUGGGACAUACUUAUGCUAAAAAAAUUAGUGU UC Precursors Length 72 bp Gene Description Homo sapiens miR-1302-7 stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0005890 Mature miRNA-1 Name hsa-miR-1302 Mature miRNA-1 sequence UUGGGACAUACUUAUGCUAAA Chromosome Location Chromosome 8:142865510:142865581 (- Strand) |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.