Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MILHS0490
| Cat. No. | MILHS0490 |
| Species | Human |
| Reporter | GFP |
| Resistance | Ampr |
| Titer | 106 pfu/ml |
| Size | 250 ul |
| Vector Type | Adenovirus |
|
|
Precursor Accession No. MI0006323 Precursor Name hsa-mir-1233-1 Precursors sequence GUGAGUGGGAGGCCAGGGCACGGCAGGGGGAGCUG CAGGGCUAUGGGAGGGGCCCCAGCGUCUGAGCCCU GUCCUCCCGCAG Precursors Length 82 bp Gene Description Homo sapiens miR-1233-1 stem-loop Gene Species Human Mature miRNA-1 AccessionNo. MIMAT0022943 Mature miRNA-1 Name hsa-miR-1233-1-5p Mature miRNA-1 sequence AGUGGGAGGCCAGGGCACGGCA Mature miRNA-2 Accession No. MIMAT0005588 Mature miRNA-2 Name hsa-miR-1233-3p Mature miRNA-2 sequence UGAGCCCUGUCCUCCCGCAG Chromosome Location Chromosome 15:32607783:32607864 (- Strand) |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.