Tel: 1-631-626-9181 (USA)   44-207-097-1828 (Europe)

miR-hsa-miR-99a mimics

Cat.No
MIMH1212
Species
Human
miRNA Name
hsa-miR-99a
Sequence
AACCCGUAGAUCCGAUCUUGUG
Inventory
5-7 days
Size/form
5 nmol

Quick Inquiry

Please input "biogene" as verification code.

Contact Us

USA

Europe

CBpromise   

Our promise to you:
Guaranteed product quality, expert customer support.

24x7 CUSTOMER SERVICE
CONTACT US TO ORDER