Pages
Products

miR-hsa-miR-943 mimics

For research use only. Not intended for any clinical use.

Cat. No. :   MIMH1208

Inquire for Price

Product Information

Cat. No. MIMH1208
Species Human
Size 5 nmol
Sequence CUGACUGUUGCCGUCCUCCAG
Inventory 5-7 days
Quick Inquiry

Q & A

Customer Reviews

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction