Tel: 1-631-626-9181 (USA)   44-207-097-1828 (Europe)
  Email:

miR-hsa-miR-92b-5p mimics

Cat.No.
MIMH0098
Inventory
5-7 days
Sequence
AGGGACGGGACGCGGUGCAGUG
Size/Form
5nmol
Species
Human

Quick Inquiry

   Please input "biogene" as verification code.