Creative biogene
SHARE THIS
facebook twitterlinkedingoogle plusStumbleUpon blog


miR-hsa-miR-548j mimics

Cat.No
MIMH1124
Species
Human
miRNA Name
hsa-miR-548j
Sequence
AAAAGUAAUUGCGGUCUUUGGU
Inventory
5-7 days
Size/form
5 nmol
Related Products
Cat#
Product Name
Titer
Product Size
Species
Price
AD02044W
1X10^9 viral particles/ml
1 x 0.2 ml
Human
Cat#
Product Name
Size/Form
Species
Price

Related Services

Quick Inquiry

Please input "biogene" as verification code.
Contact us to order
USA
45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828
Email: info@creative-biogene.com

Europe
Tel: 44-207-097-1828
Email: info@creative-biogene.com
CBpromise

24x7 CUSTOMER SERVICE

CONTACT US TO ORDER

;

CONTACT CREATIVE BIOGENE

45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828
Email: info@creative-biogene.com

Europe
Tel: 44-207-097-1828

Terms & Conditions | Privacy Policy | Sitemap | FAQ | © 2010-2018 Creative Biogene. All Rights Reserved.