Pages
Products

miR-hsa-miR-34a mimics

For research use only. Not intended for any clinical use.

Cat. No. :   MIMH1033

Inquire for Price

Product Information

Cat. No. MIMH1033
Species Human
Size 5 nmol
Sequence UGGCAGUGUCUUAGCUGGUUGU
Inventory 5-7 days
Quick Inquiry

Publications

Q & A

Customer Reviews

Publications

  1. Hu Y, Ma X, Wu Z, et al. MicroRNA‐34a‐mediated death of acute myeloid leukemia stem cells through apoptosis induction and exosome shedding inhibition via histone deacetylase 2 targeting[J]. Iubmb Life, 2020, 72(7): 1481-1490.
Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction