Pages
Products

miR-hsa-miR-206 mimics

For research use only. Not intended for any clinical use.

Cat. No. :   MIMH0250

Inquire for Price

Product Information

Cat. No. MIMH0250
Species Human
Size 5 nmol
Sequence UGGAAUGUAAGGAAGUGUGUGG
Inventory 5-7 days
Quick Inquiry

Publications

Q & A

Customer Reviews

Publications

  1. Wang Y, Tai Q, Zhang J, et al. MiRNA-206 inhibits hepatocellular carcinoma cell proliferation and migration but promotes apoptosis by modulating cMET expression[J]. Acta biochimica et biophysica Sinica, 2019, 51(3): 243-253.
  2. Wu H, Tao J, Li X, et al. Microrna‐206 prevents the pathogenesis of hepatocellular carcinoma by modulating expression of met proto‐oncogene and cyclin‐dependent kinase 6 in mice[J]. Hepatology, 2017, 66(6): 1952-1967.
Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.

Write a Review

Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.

Needs improvement

Satisfaction

General satisfaction

Very satisfaction