Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MIMH0250
| Cat. No. | MIMH0250 |
| Species | Human |
| Size | 5 nmol |
| Sequence | UGGAAUGUAAGGAAGUGUGUGG |
| Inventory | 5-7 days |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.