Creative biogene
SHARE THIS
facebook twitterlinkedingoogle plusStumbleUpon blog


miR-hsa-miR-128 mimics

Cat.No
MIMH0139
Species
Human
miRNA Name
hsa-miR-128
Sequence
UCACAGUGAACCGGUCUCUUU
Inventory
5-7 days
Size/form
5nmol
Related Products
Cat#
Product Name
Titer
Product Size
Species
Price
AD02093W
1X10^9 viral particles/ml
1 x 0.2 ml
Human
AD01942W
1X10^9 viral particles/ml
1 x 0.2 ml
Human
Cat#
Product Name
Size/Form
Species
Price
MIPM3065
100 μL of bacterial glycerol stock
mouse
MIPMS0348
purified plasmid or bacterial stock
Mouse
MIPMS2784
purified plasmid or bacterial stock
Mouse
MIPM3066
100 μL of bacterial glycerol stock
mouse

Related Services

Quick Inquiry

Please input "biogene" as verification code.
Contact us to order
USA
45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828
Email: info@creative-biogene.com

Europe
Tel: 44-207-097-1828
Email: info@creative-biogene.com
CBpromise

24x7 CUSTOMER SERVICE

CONTACT US TO ORDER

;

CONTACT CREATIVE BIOGENE

45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828
Email: info@creative-biogene.com

Europe
Tel: 44-207-097-1828

Terms & Conditions | Privacy Policy | Sitemap | FAQ | © 2010-2018 Creative Biogene. All Rights Reserved.