Tel: 1-631-626-9181 (USA)    44-207-097-1828 (Europe)
  Email:

Avi

Features
Facilitates biotinylation of tagged protein by the enzyme BirA so the protein can be isolated by streptavidin.
Length
45 bp
Type
Purification tag
Sequence
GGCCTGAACGATATTTTTGAAGCGCAGAAAATTGAATGGCATGAA

Quick Inquiry

   Please input "biogene" as verification code.