Tel: 1-631-626-9181 (USA)    44-207-097-1828 (Europe)
  Email:

3xFLAG

Features
Facilitates antibody binding of tagged protein.
Length
66 bp
Type
Epitope tag
Sequence
GACTACAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAG

Quick Inquiry

   Please input "biogene" as verification code.