Transfected Stable Cell Lines
Reliable | High-Performance | Wide Rage
Precision reporter, kinase, immune receptor, biosimilar, Cas9, and knockout stable cell lines for diverse applications.
Cat. No. : MIPH2396
| Cat. No. | MIPH2396 |
| Description | Expression plasmid for human microRNA MIR638. All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA. Both mature and minor (star) miRNA can be over expressed from the construct. |
| Species | Human |
| Reporter | GFP |
| Size | The plasmid is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5 and 3 vector primers in separate vials. |
| Vector Type | plasmid |
|
Precursor Accession No. MI0003653 Precursor Name hsa-mir-638 Precursors sequence GUGAGCGGGCGCGGCAGGGAUCGCGGGCGGGUGGC GGCCUAGGGCGCGGAGGGCGGACCGGGAAUGGCGC GCCGUGCGCCGCCGGCGUAACUGCGGCGCU Precursors Length 100 bp Gene Description Homo sapiens miR-638 stem-loop Gene Species Human Mature miRNA-1 Accession No. MIMAT0003308 Mature miRNA-1 Name hsa-miR-638 Mature miRNA-1 sequence AGGGAUCGCGGGCGGGUGGCGGCCU |
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
Write a review of your use of Biogene products and services in your research. Your review can help your fellow researchers make informed purchasing decisions.